Search our product database

Search options:
Product name: hSKA3 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08817-1
Sigma Product ID: EHU088171
Species: Homo sapiens
Ensembl Gene ID: ENSG00000165480
Ensembl Transcript ID: ENST00000298260, ENST00000314759, ENST00000400018
Gene coordinates (GRCh38): 13:21153595-21176602
HGNC Alias: C13orf3, MGC4832, RAMA1
HGNC ID: HGNC:20262
HGNC Symbol: SKA3
NCBI gene: 221150
RefSeq mRNA: NM_001166017, NM_145061
Sequence:TCCCCCTTTAAACGTTGACCCATTTTAAAGACAAACATGAACATTAACATCATAA
TATGCTTTTTATGAAGTTTCAATAAGGTTTAACCTTAGTCTTGTTGACATGTAGC
CCAGTCATTCACTCTTTAAGGATTATTAGTGTTTCATTGATACTAAATTACCCAG
CTTAATCAACAGAATGGTTTAAGTAGTACCAGGAAGTAGGACAAGTAATTTCAAA
AATATAAAGGTGTTTGCTACTCAGATGAGGCCGCCCCTGACCTTCTGGCCAGAGA
GACATTGCTGCCAGCCAGCTCTGCCTTCCCATCATCTCCTTTCAGGACCGTCCCA
CACCTTTTACTTGCTCAGTGCTGTCTGAAGATGCAGTTGCTGTTTGCAAACAACA
GGAACACCAGTTAAACTAATTAGGAAAAGAGGGAGATTTCCAGGC
Product name: hSKA3 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08817-1
Sigma Product ID: EHU088171
Species: Homo sapiens
Ensembl Gene ID: ENSG00000165480
Ensembl Transcript ID: ENST00000298260, ENST00000314759, ENST00000400018
Gene coordinates (GRCh38): 13:21153595-21176602
HGNC Alias: C13orf3, MGC4832, RAMA1
HGNC ID: HGNC:20262
HGNC Symbol: SKA3
NCBI gene: 221150
RefSeq mRNA: NM_001166017, NM_145061
Sequence:TCCCCCTTTAAACGTTGACCCATTTTAAAGACAAACATGAACATTAACATCATAA
TATGCTTTTTATGAAGTTTCAATAAGGTTTAACCTTAGTCTTGTTGACATGTAGC
CCAGTCATTCACTCTTTAAGGATTATTAGTGTTTCATTGATACTAAATTACCCAG
CTTAATCAACAGAATGGTTTAAGTAGTACCAGGAAGTAGGACAAGTAATTTCAAA
AATATAAAGGTGTTTGCTACTCAGATGAGGCCGCCCCTGACCTTCTGGCCAGAGA
GACATTGCTGCCAGCCAGCTCTGCCTTCCCATCATCTCCTTTCAGGACCGTCCCA
CACCTTTTACTTGCTCAGTGCTGTCTGAAGATGCAGTTGCTGTTTGCAAACAACA
GGAACACCAGTTAAACTAATTAGGAAAAGAGGGAGATTTCCAGGC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.