Search our product database

Search options:
Product name: hATXN3 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08914-1
Sigma Product ID: EHU089141
Species: Homo sapiens
Ensembl Gene ID: ENSG00000066427
Ensembl Transcript ID: ENST00000359366, ENST00000393287, ENST00000429774, ENST00000502250, ENST00000545170, ENST00000558190, ENST00000644486
Gene coordinates (GRCh38): 14:92044496-92106625
HGNC Alias: ATX3, JOS, MJD, SCA3
HGNC ID: HGNC:7106
HGNC Symbol: ATXN3
NCBI gene: 4287
RefSeq mRNA: NM_001127697, NM_001164778, NM_001164779, NM_001164780, NM_001164781, NM_004993
RefSeq ncRNA: NR_028453, NR_028455, NR_028456, NR_028458, NR_028459, NR_028461, NR_028462, NR_028464, NR_028465, NR_028467
Sequence:CCTGTGTGATTACAGCATAGGGTCCACTTTGGTAATGTGTCAAAGAGATGAGGAA
ATAAGACTTTTAGCGGTTTGCAAACAAAATGATGGGAAAGTGGAACAATGCGTCG
GTTGTAGGACTAAATAATGATCTTCCAAATATTAGCCAAAGAGGCATTCAGCAAT
TAAAGACATTTAAAATAGTTTTCTAAATGTTTCTTTTTCTTTTTTGAGTGTGCAA
TATGTAACATGTCTAAAGTTAGGGCATTTTTCTTGGATCTTTTTGCAGACTAGCT
AATTAGCTCTCGCCTCAGGCTTTTTCCATATAGTTTGTTTTCTTTTTCTGTCTTG
TAGGTAAGTTGGCTCACATCATGTAATAGTGGCTTTCATTTCTTATTAACCAAAT
TAACCTTTCAGGAAA
Product name: hATXN3 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08914-1
Sigma Product ID: EHU089141
Species: Homo sapiens
Ensembl Gene ID: ENSG00000066427
Ensembl Transcript ID: ENST00000359366, ENST00000393287, ENST00000429774, ENST00000502250, ENST00000545170, ENST00000558190, ENST00000644486
Gene coordinates (GRCh38): 14:92044496-92106625
HGNC Alias: ATX3, JOS, MJD, SCA3
HGNC ID: HGNC:7106
HGNC Symbol: ATXN3
NCBI gene: 4287
RefSeq mRNA: NM_001127697, NM_001164778, NM_001164779, NM_001164780, NM_001164781, NM_004993
RefSeq ncRNA: NR_028453, NR_028455, NR_028456, NR_028458, NR_028459, NR_028461, NR_028462, NR_028464, NR_028465, NR_028467
Sequence:CCTGTGTGATTACAGCATAGGGTCCACTTTGGTAATGTGTCAAAGAGATGAGGAA
ATAAGACTTTTAGCGGTTTGCAAACAAAATGATGGGAAAGTGGAACAATGCGTCG
GTTGTAGGACTAAATAATGATCTTCCAAATATTAGCCAAAGAGGCATTCAGCAAT
TAAAGACATTTAAAATAGTTTTCTAAATGTTTCTTTTTCTTTTTTGAGTGTGCAA
TATGTAACATGTCTAAAGTTAGGGCATTTTTCTTGGATCTTTTTGCAGACTAGCT
AATTAGCTCTCGCCTCAGGCTTTTTCCATATAGTTTGTTTTCTTTTTCTGTCTTG
TAGGTAAGTTGGCTCACATCATGTAATAGTGGCTTTCATTTCTTATTAACCAAAT
TAACCTTTCAGGAAA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.