Search our product database

Search options:
Product name: hSHOC2 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08931-1
Sigma Product ID: EHU089311
Species: Homo sapiens
Ensembl Gene ID: ENSG00000108061
Ensembl Transcript ID: ENST00000265277, ENST00000369452, ENST00000451838, ENST00000489390
Gene coordinates (GRCh38): 10:110919547-111013667
HGNC Alias: KIAA0862, SOC-2, SOC2, SUR-8, SUR8
HGNC ID: HGNC:15454
HGNC Symbol: SHOC2
NCBI gene: 8036
RefSeq mRNA: NM_001269039, NM_001324336, NM_001324337, NM_007373
RefSeq ncRNA: NR_136749
Sequence:TCACTTCCCTTGGATTTTGGAACTTGGACCAGTATGGTAGAATTGAATTTAGCCA
CTAATCAGCTCACAAAGATCCCTGAGGATGTGTCTGGTCTCGTTTCTCTTGAGGT
TCTTATCTTATCAAACAATCTTCTAAAGAAGCTTCCCCATGGTCTTGGAAACCTT
AGGAAGTTAAGAGAGTTGGATCTAGAAGAGAACAAATTGGAATCCTTGCCAAATG
AAATTGCATATCTTAAGGATTTACAGAAATTAGTCTTGACAAACAACCAGTTGAC
CACTCTTCCCAGAGGCATTGGTCACCTTACTAATCTCACACATCTGGGCCTTGGA
GAGAACCTACTTACTCACCTTCCTGAAGAAATTGGTACACTGGAGAACCTAGAAG
AACTGTATTTGAATGACAACCCCAACCTGCATAGCCTTCCCTT
Product name: hSHOC2 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08931-1
Sigma Product ID: EHU089311
Species: Homo sapiens
Ensembl Gene ID: ENSG00000108061
Ensembl Transcript ID: ENST00000265277, ENST00000369452, ENST00000451838, ENST00000489390
Gene coordinates (GRCh38): 10:110919547-111013667
HGNC Alias: KIAA0862, SOC-2, SOC2, SUR-8, SUR8
HGNC ID: HGNC:15454
HGNC Symbol: SHOC2
NCBI gene: 8036
RefSeq mRNA: NM_001269039, NM_001324336, NM_001324337, NM_007373
RefSeq ncRNA: NR_136749
Sequence:TCACTTCCCTTGGATTTTGGAACTTGGACCAGTATGGTAGAATTGAATTTAGCCA
CTAATCAGCTCACAAAGATCCCTGAGGATGTGTCTGGTCTCGTTTCTCTTGAGGT
TCTTATCTTATCAAACAATCTTCTAAAGAAGCTTCCCCATGGTCTTGGAAACCTT
AGGAAGTTAAGAGAGTTGGATCTAGAAGAGAACAAATTGGAATCCTTGCCAAATG
AAATTGCATATCTTAAGGATTTACAGAAATTAGTCTTGACAAACAACCAGTTGAC
CACTCTTCCCAGAGGCATTGGTCACCTTACTAATCTCACACATCTGGGCCTTGGA
GAGAACCTACTTACTCACCTTCCTGAAGAAATTGGTACACTGGAGAACCTAGAAG
AACTGTATTTGAATGACAACCCCAACCTGCATAGCCTTCCCTT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.