Search our product database

Search options:
Product name: hZMYM4 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09008-1
Sigma Product ID: EHU090081
Species: Homo sapiens
Ensembl Gene ID: ENSG00000146463
Ensembl Transcript ID: ENST00000314607, ENST00000457946
Gene coordinates (GRCh38): 1:35268967-35422058
HGNC Alias: KIAA0425, MYM, ZNF198L3, ZNF262
HGNC ID: HGNC:13055
HGNC Symbol: ZMYM4
NCBI gene: 9202
RefSeq mRNA: NM_001350138, NM_001350139, NM_001350140, NM_005095
Sequence:CCAGTTCCCGTACCAGTGTTTGTTCCCATACCTCTTCACCTTTATACTCAATATG
CTCCAGTCCCATTTGGAATTCCAGTTCCAATGCCTGTCCCTATGCTTATTCCATC
TTCAATGGATAGTGAAGATAAAGTCACAGAGAGTATTGAAGACATTAAAGAAAAG
CTTCCCACACATCCATTTGAAGCTGATCTCCTTGAGATGGCAGAAATGATTGCAG
AAGATGAAGAGAAGAAGACTCTATCTCAGGGAGAGTCCCAAACTTCTGAACACGA
ACTCTTTCTAGACACCAAGATATTTGAAAAAGACCAAGGAAGTACATACAGTGGT
GATCTTGAATCAGAGGCAGTATCTACTCCACATAGCTGGGAGGAAGAGCTGAATC
ACTATGCCTTAAAGTCAAATGCTGTGCAAGAGGCTGATTCAG
Product name: hZMYM4 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09008-1
Sigma Product ID: EHU090081
Species: Homo sapiens
Ensembl Gene ID: ENSG00000146463
Ensembl Transcript ID: ENST00000314607, ENST00000457946
Gene coordinates (GRCh38): 1:35268967-35422058
HGNC Alias: KIAA0425, MYM, ZNF198L3, ZNF262
HGNC ID: HGNC:13055
HGNC Symbol: ZMYM4
NCBI gene: 9202
RefSeq mRNA: NM_001350138, NM_001350139, NM_001350140, NM_005095
Sequence:CCAGTTCCCGTACCAGTGTTTGTTCCCATACCTCTTCACCTTTATACTCAATATG
CTCCAGTCCCATTTGGAATTCCAGTTCCAATGCCTGTCCCTATGCTTATTCCATC
TTCAATGGATAGTGAAGATAAAGTCACAGAGAGTATTGAAGACATTAAAGAAAAG
CTTCCCACACATCCATTTGAAGCTGATCTCCTTGAGATGGCAGAAATGATTGCAG
AAGATGAAGAGAAGAAGACTCTATCTCAGGGAGAGTCCCAAACTTCTGAACACGA
ACTCTTTCTAGACACCAAGATATTTGAAAAAGACCAAGGAAGTACATACAGTGGT
GATCTTGAATCAGAGGCAGTATCTACTCCACATAGCTGGGAGGAAGAGCTGAATC
ACTATGCCTTAAAGTCAAATGCTGTGCAAGAGGCTGATTCAG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.