Search our product database

Search options:
Product name: hSMARCC2 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09081-1
Sigma Product ID: EHU090811
Species: Homo sapiens
Ensembl Gene ID: ENSG00000139613
Ensembl Transcript ID: ENST00000267064, ENST00000347471, ENST00000394023, ENST00000550164, ENST00000552674
Gene coordinates (GRCh38): 12:56162983-56189567
HGNC Alias: BAF170, CRACC2, Rsc8
HGNC ID: HGNC:11105
HGNC Symbol: SMARCC2
NCBI gene: 6601
RefSeq mRNA: NM_001130420, NM_001330288, NM_003075, NM_139067
Sequence:ACTGCCGATCAAATGTTTCCTAGATTTCAAAGCGGGAGGCTCCTTGTGCCACATT
CTTGCAGCTGCCTACAAATTCAAGAGTGACCAGGGATGGCGGCGTTACGATTTCC
AGAATCCATCACGCATGGACCGCAATGTGGAAATGTTTATGACCATTGAGAAGTC
CTTGGTGCAGAATAATTGCCTGTCTCGACCTAACATTTTTCTGTGCCCAGAAATT
GAGCCCAAACTACTAGGGAAATTAAAGGACATTATCAAGAGACACCAGGGAACAG
TCACTGAGGATAAGAACAATGCCTCCCATGTTGTGTATCCTGTCCCGGGGAATCT
AGAAGAAGAGGAATGGGTACGACCAGTCATGAAGAGGGATAAGCAGGTTCTTCTG
CACTGGGGCTACTATCCTGACAGTTACGACACGTGGATCCC
Product name: hSMARCC2 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09081-1
Sigma Product ID: EHU090811
Species: Homo sapiens
Ensembl Gene ID: ENSG00000139613
Ensembl Transcript ID: ENST00000267064, ENST00000347471, ENST00000394023, ENST00000550164, ENST00000552674
Gene coordinates (GRCh38): 12:56162983-56189567
HGNC Alias: BAF170, CRACC2, Rsc8
HGNC ID: HGNC:11105
HGNC Symbol: SMARCC2
NCBI gene: 6601
RefSeq mRNA: NM_001130420, NM_001330288, NM_003075, NM_139067
Sequence:ACTGCCGATCAAATGTTTCCTAGATTTCAAAGCGGGAGGCTCCTTGTGCCACATT
CTTGCAGCTGCCTACAAATTCAAGAGTGACCAGGGATGGCGGCGTTACGATTTCC
AGAATCCATCACGCATGGACCGCAATGTGGAAATGTTTATGACCATTGAGAAGTC
CTTGGTGCAGAATAATTGCCTGTCTCGACCTAACATTTTTCTGTGCCCAGAAATT
GAGCCCAAACTACTAGGGAAATTAAAGGACATTATCAAGAGACACCAGGGAACAG
TCACTGAGGATAAGAACAATGCCTCCCATGTTGTGTATCCTGTCCCGGGGAATCT
AGAAGAAGAGGAATGGGTACGACCAGTCATGAAGAGGGATAAGCAGGTTCTTCTG
CACTGGGGCTACTATCCTGACAGTTACGACACGTGGATCCC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.