Search our product database

Search options:
Product name: hTPX2 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09301-1
Sigma Product ID: EHU093011
Species: Homo sapiens
Ensembl Gene ID: ENSG00000088325
Ensembl Transcript ID: ENST00000300403, ENST00000340513
Gene coordinates (GRCh38): 20:31739271-31801805
HGNC Alias: C20orf1, C20orf2, DIL-2, p100
HGNC ID: HGNC:1249
HGNC Symbol: TPX2
NCBI gene: 22974
RefSeq mRNA: NM_012112
Sequence:CCCACCAAAGAAGATGAGGAAGAGGACGAACCGGTAGTGATAAAAGCTCAACCTG
TGCCACATTATGGGGTGCCTTTTAAGCCCCAAATCCCAGAGGCAAGAACTGTGGA
AATATGCCCTTTCTCGTTTGATTCTCGAGACAAAGAACGTCAGTTACAGAAGGAG
AAGAAAATAAAAGAACTGCAGAAAGGGGAGGTGCCCAAGTTCAAGGCACTTCCCT
TGCCTCATTTTGACACCATTAACCTGCCAGAGAAGAAGGTAAAGAATGTGACCCA
GATTGAACCTTTCTGCTTGGAGACTGACAGAAGAGGTGCTCTGAAGGCACAGACT
TGGAAGCACCAGCTGGAAGAAGAACTGAGACAGCAGAAAGAAGCAGCTTGTTTCA
AGGCTCGTCCAAACACCGTCATCTCTCAGGAGCCCTTTG
Product name: hTPX2 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09301-1
Sigma Product ID: EHU093011
Species: Homo sapiens
Ensembl Gene ID: ENSG00000088325
Ensembl Transcript ID: ENST00000300403, ENST00000340513
Gene coordinates (GRCh38): 20:31739271-31801805
HGNC Alias: C20orf1, C20orf2, DIL-2, p100
HGNC ID: HGNC:1249
HGNC Symbol: TPX2
NCBI gene: 22974
RefSeq mRNA: NM_012112
Sequence:CCCACCAAAGAAGATGAGGAAGAGGACGAACCGGTAGTGATAAAAGCTCAACCTG
TGCCACATTATGGGGTGCCTTTTAAGCCCCAAATCCCAGAGGCAAGAACTGTGGA
AATATGCCCTTTCTCGTTTGATTCTCGAGACAAAGAACGTCAGTTACAGAAGGAG
AAGAAAATAAAAGAACTGCAGAAAGGGGAGGTGCCCAAGTTCAAGGCACTTCCCT
TGCCTCATTTTGACACCATTAACCTGCCAGAGAAGAAGGTAAAGAATGTGACCCA
GATTGAACCTTTCTGCTTGGAGACTGACAGAAGAGGTGCTCTGAAGGCACAGACT
TGGAAGCACCAGCTGGAAGAAGAACTGAGACAGCAGAAAGAAGCAGCTTGTTTCA
AGGCTCGTCCAAACACCGTCATCTCTCAGGAGCCCTTTG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.