Search our product database

Search options:
Product name: hAIG1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09342-1
Sigma Product ID: EHU093421
Species: Homo sapiens
Ensembl Gene ID: ENSG00000146416
Ensembl Transcript ID: ENST00000275235, ENST00000357847, ENST00000458219, ENST00000646199
Gene coordinates (GRCh38): 6:143060496-143340304
HGNC Alias: AIG-1, dJ95L4.1, FLJ10485
HGNC ID: HGNC:21607
HGNC Symbol: AIG1
NCBI gene: 51390
RefSeq mRNA: NM_001286587, NM_016108
Sequence:TAGCTGTGTTGGCCTTTCCTGTTGGGGTTTTTGTTGTAGCAGTGTTCTGGATCAT
TTATGCCTATGACAGAGAGATGATATACCCGAAGCTGCTGGATAATTTTATCCCA
GGGTGGCTGAATCACGGAATGCACACGACGGTTCTGCCCTTTATATTAATCGAGA
TGAGGACATCGCACCATCAGTATCCCAGCAGGAGCAGCGGACTTACCGCCATATG
TACCTTCTCTGTTGGCTATATATTATGGGTGTGCTGGGTGCATCATGTAACTGGC
ATGTGGGTGTACCCTTTCCTGGAACACATTGGCCCAGGAGCCAGAATCATCTTCT
TTGGGTCTACAACCATCTTAATGAACTTCCTGTACCTGCTGGGA
Product name: hAIG1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09342-1
Sigma Product ID: EHU093421
Species: Homo sapiens
Ensembl Gene ID: ENSG00000146416
Ensembl Transcript ID: ENST00000275235, ENST00000357847, ENST00000458219, ENST00000646199
Gene coordinates (GRCh38): 6:143060496-143340304
HGNC Alias: AIG-1, dJ95L4.1, FLJ10485
HGNC ID: HGNC:21607
HGNC Symbol: AIG1
NCBI gene: 51390
RefSeq mRNA: NM_001286587, NM_016108
Sequence:TAGCTGTGTTGGCCTTTCCTGTTGGGGTTTTTGTTGTAGCAGTGTTCTGGATCAT
TTATGCCTATGACAGAGAGATGATATACCCGAAGCTGCTGGATAATTTTATCCCA
GGGTGGCTGAATCACGGAATGCACACGACGGTTCTGCCCTTTATATTAATCGAGA
TGAGGACATCGCACCATCAGTATCCCAGCAGGAGCAGCGGACTTACCGCCATATG
TACCTTCTCTGTTGGCTATATATTATGGGTGTGCTGGGTGCATCATGTAACTGGC
ATGTGGGTGTACCCTTTCCTGGAACACATTGGCCCAGGAGCCAGAATCATCTTCT
TTGGGTCTACAACCATCTTAATGAACTTCCTGTACCTGCTGGGA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.