Search our product database

Search options:
Product name: hAIG1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09342-1
Sigma Product ID: EHU093421
Species: Homo sapiens
Ensembl Gene ID: ENSG00000146416
Ensembl Transcript ID: ENST00000275235, ENST00000357847, ENST00000458219, ENST00000646199
Gene coordinates (GRCh38): 6:143060496-143341058
HGNC Alias: AIG-1, dJ95L4.1, FLJ10485
HGNC ID: HGNC:21607
HGNC Symbol: AIG1
NCBI gene: 51390
RefSeq mRNA: NM_001286587, NM_001363721, NM_001366344, NM_001366345, NM_001366346, NM_001366347, NM_001366348, NM_001366349, NM_001366350, NM_001366351, NM_001366352, NM_001366353, NM_001366354, NM_001366355, NM_001366358, NM_001366361, NM_016108
RefSeq ncRNA: NR_158896, NR_158960
Sequence:TAGCTGTGTTGGCCTTTCCTGTTGGGGTTTTTGTTGTAGCAGTGTTCTGGATCAT
TTATGCCTATGACAGAGAGATGATATACCCGAAGCTGCTGGATAATTTTATCCCA
GGGTGGCTGAATCACGGAATGCACACGACGGTTCTGCCCTTTATATTAATCGAGA
TGAGGACATCGCACCATCAGTATCCCAGCAGGAGCAGCGGACTTACCGCCATATG
TACCTTCTCTGTTGGCTATATATTATGGGTGTGCTGGGTGCATCATGTAACTGGC
ATGTGGGTGTACCCTTTCCTGGAACACATTGGCCCAGGAGCCAGAATCATCTTCT
TTGGGTCTACAACCATCTTAATGAACTTCCTGTACCTGCTGGGA
Product name: hAIG1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09342-1
Sigma Product ID: EHU093421
Species: Homo sapiens
Ensembl Gene ID: ENSG00000146416
Ensembl Transcript ID: ENST00000275235, ENST00000357847, ENST00000458219, ENST00000646199
Gene coordinates (GRCh38): 6:143060496-143341058
HGNC Alias: AIG-1, dJ95L4.1, FLJ10485
HGNC ID: HGNC:21607
HGNC Symbol: AIG1
NCBI gene: 51390
RefSeq mRNA: NM_001286587, NM_001363721, NM_001366344, NM_001366345, NM_001366346, NM_001366347, NM_001366348, NM_001366349, NM_001366350, NM_001366351, NM_001366352, NM_001366353, NM_001366354, NM_001366355, NM_001366358, NM_001366361, NM_016108
RefSeq ncRNA: NR_158896, NR_158960
Sequence:TAGCTGTGTTGGCCTTTCCTGTTGGGGTTTTTGTTGTAGCAGTGTTCTGGATCAT
TTATGCCTATGACAGAGAGATGATATACCCGAAGCTGCTGGATAATTTTATCCCA
GGGTGGCTGAATCACGGAATGCACACGACGGTTCTGCCCTTTATATTAATCGAGA
TGAGGACATCGCACCATCAGTATCCCAGCAGGAGCAGCGGACTTACCGCCATATG
TACCTTCTCTGTTGGCTATATATTATGGGTGTGCTGGGTGCATCATGTAACTGGC
ATGTGGGTGTACCCTTTCCTGGAACACATTGGCCCAGGAGCCAGAATCATCTTCT
TTGGGTCTACAACCATCTTAATGAACTTCCTGTACCTGCTGGGA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.