Search our product database

Search options:
Product name: hSUV39H2 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09365-1
Sigma Product ID: EHU093651
Species: Homo sapiens
Ensembl Gene ID: ENSG00000152455
Ensembl Transcript ID: ENST00000313519, ENST00000358298, ENST00000378325, ENST00000378331
Gene coordinates (GRCh38): 10:14878820-14904315
HGNC Alias: FLJ23414, KMT1B
HGNC ID: HGNC:17287
HGNC Symbol: SUV39H2
NCBI gene: 79723
RefSeq mRNA: NM_001193425, NM_001193426, NM_024670
RefSeq ncRNA: NR_034181
Sequence:GGAGCTGTGACTTGCAGAGGTTACCTCAACTGAACTTTTTCAGGAAATAGAGCTG
ATGATTATAATATTTTTTTCCTAATGTTAACATTTTTAAAAATACATATTTGGGA
CTCTTATTATCAAGGTTCTACCTATGTTAATTTACAATTCATGTTTCAAGACATT
TGCCAAATGTATTACCGATGCCTCTGAAAAGGGGGTCACTGGGTCTCATAGACTG
ATATGAAGTCGACATATTTATAGTGCTTAGAGACCAAACTAATGGAAGGCAGACT
ATTTACAGCTTAGTATATGTGTACTTAAGTCTATGTGAACAGAGAAATGCCTCCC
GTAGTGTTTGAAAGCGTTAAGCTGATAATGTAATTAACAACTGCTGAGAGATCAA
AGATTCAACTTGCCATACACCTCAAATTCGGAGAAACA
Product name: hSUV39H2 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09365-1
Sigma Product ID: EHU093651
Species: Homo sapiens
Ensembl Gene ID: ENSG00000152455
Ensembl Transcript ID: ENST00000313519, ENST00000358298, ENST00000378325, ENST00000378331
Gene coordinates (GRCh38): 10:14878820-14904315
HGNC Alias: FLJ23414, KMT1B
HGNC ID: HGNC:17287
HGNC Symbol: SUV39H2
NCBI gene: 79723
RefSeq mRNA: NM_001193425, NM_001193426, NM_024670
RefSeq ncRNA: NR_034181
Sequence:GGAGCTGTGACTTGCAGAGGTTACCTCAACTGAACTTTTTCAGGAAATAGAGCTG
ATGATTATAATATTTTTTTCCTAATGTTAACATTTTTAAAAATACATATTTGGGA
CTCTTATTATCAAGGTTCTACCTATGTTAATTTACAATTCATGTTTCAAGACATT
TGCCAAATGTATTACCGATGCCTCTGAAAAGGGGGTCACTGGGTCTCATAGACTG
ATATGAAGTCGACATATTTATAGTGCTTAGAGACCAAACTAATGGAAGGCAGACT
ATTTACAGCTTAGTATATGTGTACTTAAGTCTATGTGAACAGAGAAATGCCTCCC
GTAGTGTTTGAAAGCGTTAAGCTGATAATGTAATTAACAACTGCTGAGAGATCAA
AGATTCAACTTGCCATACACCTCAAATTCGGAGAAACA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.