Search our product database

Search options:
Product name: hAFTPH €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09387-1
Sigma Product ID: EHU093871
Species: Homo sapiens
Ensembl Gene ID: ENSG00000119844
Ensembl Transcript ID: ENST00000238855, ENST00000238856, ENST00000409933, ENST00000498706
Gene coordinates (GRCh38): 2:64524305-64593005
HGNC Alias: FLJ20080, FLJ23793, MGC33965, Nbla10388
HGNC ID: HGNC:25951
HGNC Symbol: AFTPH
NCBI gene: 54812
RefSeq mRNA: NM_001002243, NM_017657, NM_203437
Sequence:GCCCTTCTGGTGTAGGGTTTGTTGATTTCGATACACCAGATTATACTCGTCCCAA
GGAAGAGTTTGTACCTTCAAACCATTTTATGCCAATTCATGAATTCTCAGAAAAT
GTAGATAGCCTTACAAGCTTTAAGTCCATTAAAAATGGTAATGATAAGGACATCA
CTGCTGAACTTTCTGCTCCTGTGAAAGGACAGTCTGATGTTTTACTTTCTACCAC
CAGCAAAGAAATAATTTCATCTGAAATGTTAGCTACTTCCATTGATGGCATGGAA
AGACCAGGAAATTTAAATAAAGTAGTGGAGCAGAGACAGAATGTTGGAACACTTG
AAAGTTTCTCTCCAGGAGATTTTAGAACTAATATGAATGTTGTTCATCAAAACAA
GCAGTTAGAGAGCTGCAATGGTGAAAAGCCTCCTTGTC
Product name: hAFTPH €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09387-1
Sigma Product ID: EHU093871
Species: Homo sapiens
Ensembl Gene ID: ENSG00000119844
Ensembl Transcript ID: ENST00000238855, ENST00000238856, ENST00000409933, ENST00000498706
Gene coordinates (GRCh38): 2:64524305-64593005
HGNC Alias: FLJ20080, FLJ23793, MGC33965, Nbla10388
HGNC ID: HGNC:25951
HGNC Symbol: AFTPH
NCBI gene: 54812
RefSeq mRNA: NM_001002243, NM_017657, NM_203437
Sequence:GCCCTTCTGGTGTAGGGTTTGTTGATTTCGATACACCAGATTATACTCGTCCCAA
GGAAGAGTTTGTACCTTCAAACCATTTTATGCCAATTCATGAATTCTCAGAAAAT
GTAGATAGCCTTACAAGCTTTAAGTCCATTAAAAATGGTAATGATAAGGACATCA
CTGCTGAACTTTCTGCTCCTGTGAAAGGACAGTCTGATGTTTTACTTTCTACCAC
CAGCAAAGAAATAATTTCATCTGAAATGTTAGCTACTTCCATTGATGGCATGGAA
AGACCAGGAAATTTAAATAAAGTAGTGGAGCAGAGACAGAATGTTGGAACACTTG
AAAGTTTCTCTCCAGGAGATTTTAGAACTAATATGAATGTTGTTCATCAAAACAA
GCAGTTAGAGAGCTGCAATGGTGAAAAGCCTCCTTGTC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.