Search our product database

Search options:
Product name: hEDC4 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09443-1
Sigma Product ID: EHU094431
Species: Homo sapiens
Ensembl Gene ID: ENSG00000038358
Ensembl Transcript ID: ENST00000358933, ENST00000536072, ENST00000572221, ENST00000573992, ENST00000574770
Gene coordinates (GRCh38): 16:67873023-67884503
HGNC Alias: Ge-1, HEDLS, RCD-8
HGNC ID: HGNC:17157
HGNC Symbol: EDC4
NCBI gene: 23644
RefSeq mRNA: NM_014329
Sequence:ACCTGGCCTGTGGATGTTAGCCAGATCAAGCAGGGCTTCATTGTGGTAAAAGGTC
ATAGCACGTGCCTCAGTGAAGGAGCCCTCTCTCCTGATGGGACTGTGCTGGCTAC
TGCGAGCCACGATGGCTATGTCAAGTTCTGGCAGATCTACATTGAGGGGCAAGAT
GAGCCAAGGTGTCTGCACGAGTGGAAACCTCATGATGGGCGGCCCCTCTCCTGCC
TCCTGTTCTGTGACAACCATAAGAAACAAGACCCTGATGTCCCTTTCTGGAGGTT
CCTTATTACTGGTGCTGACCAGAACCGAGAGTTAAAGATGTGGTGTACAGTATCC
TGGACCTGCCTGCAGACTATTCGCTTCTCCCCAGATATCTTCAGCTCAGTGAGTG
TGCCCCCTAGCCTCAAGGTTTGCTTGGACCTCTCAGC
Product name: hEDC4 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09443-1
Sigma Product ID: EHU094431
Species: Homo sapiens
Ensembl Gene ID: ENSG00000038358
Ensembl Transcript ID: ENST00000358933, ENST00000536072, ENST00000572221, ENST00000573992, ENST00000574770
Gene coordinates (GRCh38): 16:67873023-67884503
HGNC Alias: Ge-1, HEDLS, RCD-8
HGNC ID: HGNC:17157
HGNC Symbol: EDC4
NCBI gene: 23644
RefSeq mRNA: NM_014329
Sequence:ACCTGGCCTGTGGATGTTAGCCAGATCAAGCAGGGCTTCATTGTGGTAAAAGGTC
ATAGCACGTGCCTCAGTGAAGGAGCCCTCTCTCCTGATGGGACTGTGCTGGCTAC
TGCGAGCCACGATGGCTATGTCAAGTTCTGGCAGATCTACATTGAGGGGCAAGAT
GAGCCAAGGTGTCTGCACGAGTGGAAACCTCATGATGGGCGGCCCCTCTCCTGCC
TCCTGTTCTGTGACAACCATAAGAAACAAGACCCTGATGTCCCTTTCTGGAGGTT
CCTTATTACTGGTGCTGACCAGAACCGAGAGTTAAAGATGTGGTGTACAGTATCC
TGGACCTGCCTGCAGACTATTCGCTTCTCCCCAGATATCTTCAGCTCAGTGAGTG
TGCCCCCTAGCCTCAAGGTTTGCTTGGACCTCTCAGC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.