Search our product database

Search options:
Product name: hSRRT (1) €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09618-1
Sigma Product ID: EHU096181
Species: Homo sapiens
Ensembl Gene ID: ENSG00000087087
Ensembl Transcript ID: ENST00000423692, ENST00000611405, ENST00000614484, ENST00000618262, ENST00000618411, ENST00000641476
Gene coordinates (GRCh38): 7:100875111-100888664
HGNC Alias: ARS2, Asr2, serrate
HGNC ID: HGNC:24101
HGNC Symbol: SRRT
NCBI gene: 51593
RefSeq mRNA: NM_001128852, NM_001128853, NM_001128854, NM_015908
Sequence:GCAGAGATTGACCTGGGTGTGCCGCCGCCCGTGATGAAGACCTTCAAGGAGTTTC
TCCTCTCCCTGGATGACTCGGTGGATGAGACGGAGGCCGTCAAGCGCTATAATGA
CTACAAGCTGGATTTCCGGAGGCAACAGATGCAGGATTTCTTCCTGGCGCACAAA
GATGAGGAGTGGTTTCGGTCTAAGTACCACCCAGATGAGGTGGGGAAGCGTCGGC
AGGAGGCCCGGGGGGCCCTGCAAAACCGACTGAGGGTCTTCCTGTCCCTCATGGA
GACTGGCTGGTTTGATAACCTTCTCCTGGACATAGACAAAGCTGATGCCATTGTC
AAGATGC
Product name: hSRRT (1) €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09618-1
Sigma Product ID: EHU096181
Species: Homo sapiens
Ensembl Gene ID: ENSG00000087087
Ensembl Transcript ID: ENST00000423692, ENST00000611405, ENST00000614484, ENST00000618262, ENST00000618411, ENST00000641476
Gene coordinates (GRCh38): 7:100875111-100888664
HGNC Alias: ARS2, Asr2, serrate
HGNC ID: HGNC:24101
HGNC Symbol: SRRT
NCBI gene: 51593
RefSeq mRNA: NM_001128852, NM_001128853, NM_001128854, NM_015908
Sequence:GCAGAGATTGACCTGGGTGTGCCGCCGCCCGTGATGAAGACCTTCAAGGAGTTTC
TCCTCTCCCTGGATGACTCGGTGGATGAGACGGAGGCCGTCAAGCGCTATAATGA
CTACAAGCTGGATTTCCGGAGGCAACAGATGCAGGATTTCTTCCTGGCGCACAAA
GATGAGGAGTGGTTTCGGTCTAAGTACCACCCAGATGAGGTGGGGAAGCGTCGGC
AGGAGGCCCGGGGGGCCCTGCAAAACCGACTGAGGGTCTTCCTGTCCCTCATGGA
GACTGGCTGGTTTGATAACCTTCTCCTGGACATAGACAAAGCTGATGCCATTGTC
AAGATGC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.