Search our product database

Search options:
Product name: hUSP39 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09802-1
Sigma Product ID: EHU098021
Species: Homo sapiens
Ensembl Gene ID: ENSG00000168883
Ensembl Transcript ID: ENST00000323701, ENST00000409025, ENST00000409470, ENST00000409766, ENST00000450066, ENST00000459775, ENST00000493829, ENST00000613444
Gene coordinates (GRCh38): 2:85602856-85649282
HGNC Alias: CGI-21, SAD1, SNRNP65
HGNC ID: HGNC:20071
HGNC Symbol: USP39
NCBI gene: 10713
RefSeq mRNA: NM_001256725, NM_001256726, NM_001256727, NM_001256728, NM_006590
RefSeq ncRNA: NR_046347
Sequence:TGCAAACTTGGACAAGCAAGCCAAATTGTCCCGGGCATATGATGGTACCACTTAC
CTGCCGGGTATTGTGGGACTGAATAACATAAAGGCCAATGATTATGCCAACGCTG
TCCTTCAGGCTCTATCTAATGTTCCTCCTCTCCGGAACTACTTTCTGGAAGAAGA
CAATTATAAGAACATCAAACGTCCTCCAGGGGATATCATGTTCTTGTTGGTCCAG
CGTTTTGGAGAGCTGATGAGAAAGCTCTGGAACCCTCGAAATTTCA
Product name: hUSP39 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09802-1
Sigma Product ID: EHU098021
Species: Homo sapiens
Ensembl Gene ID: ENSG00000168883
Ensembl Transcript ID: ENST00000323701, ENST00000409025, ENST00000409470, ENST00000409766, ENST00000450066, ENST00000459775, ENST00000493829, ENST00000613444
Gene coordinates (GRCh38): 2:85602856-85649282
HGNC Alias: CGI-21, SAD1, SNRNP65
HGNC ID: HGNC:20071
HGNC Symbol: USP39
NCBI gene: 10713
RefSeq mRNA: NM_001256725, NM_001256726, NM_001256727, NM_001256728, NM_006590
RefSeq ncRNA: NR_046347
Sequence:TGCAAACTTGGACAAGCAAGCCAAATTGTCCCGGGCATATGATGGTACCACTTAC
CTGCCGGGTATTGTGGGACTGAATAACATAAAGGCCAATGATTATGCCAACGCTG
TCCTTCAGGCTCTATCTAATGTTCCTCCTCTCCGGAACTACTTTCTGGAAGAAGA
CAATTATAAGAACATCAAACGTCCTCCAGGGGATATCATGTTCTTGTTGGTCCAG
CGTTTTGGAGAGCTGATGAGAAAGCTCTGGAACCCTCGAAATTTCA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.