Search our product database

Search options:
Product name: hCENPA €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09808-1
Sigma Product ID: EHU098081
Species: Homo sapiens
Ensembl Gene ID: ENSG00000115163
Ensembl Transcript ID: ENST00000233505, ENST00000335756, ENST00000475662
Gene coordinates (GRCh38): 2:26764289-26801067
HGNC Alias: CenH3, CENP-A
HGNC ID: HGNC:1851
HGNC Symbol: CENPA
NCBI gene: 1058
RefSeq mRNA: NM_001042426, NM_001809
Sequence:GACAATCAACACCGTTCCAAAGGCCTGAAAATAATTTTCAGATAAAGAGACTCCA
AGGTTGACTTTAGTTTGTGAGTTACTCATGTGACTATTTGAGGATTTTGAAAACA
TCAGATTTGCTGTGGTATGGGAGAAAAGGCTATGTACTTATTATTTTAGCTCTTT
CTGTAATATTTACATTTTTTACCATATGTACATTTGTACTTTTATTTTACACATA
AGGGAAAAAATAAGACCACTTTGAGCAGTTGCCTGGAAGGCTGGGCATTTCCATC
ATATAGACCTCTGCCCTTCAGAGTAGCCTCACCATTAGTGGCAGCATC
Product name: hCENPA €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09808-1
Sigma Product ID: EHU098081
Species: Homo sapiens
Ensembl Gene ID: ENSG00000115163
Ensembl Transcript ID: ENST00000233505, ENST00000335756, ENST00000475662
Gene coordinates (GRCh38): 2:26764289-26801067
HGNC Alias: CenH3, CENP-A
HGNC ID: HGNC:1851
HGNC Symbol: CENPA
NCBI gene: 1058
RefSeq mRNA: NM_001042426, NM_001809
Sequence:GACAATCAACACCGTTCCAAAGGCCTGAAAATAATTTTCAGATAAAGAGACTCCA
AGGTTGACTTTAGTTTGTGAGTTACTCATGTGACTATTTGAGGATTTTGAAAACA
TCAGATTTGCTGTGGTATGGGAGAAAAGGCTATGTACTTATTATTTTAGCTCTTT
CTGTAATATTTACATTTTTTACCATATGTACATTTGTACTTTTATTTTACACATA
AGGGAAAAAATAAGACCACTTTGAGCAGTTGCCTGGAAGGCTGGGCATTTCCATC
ATATAGACCTCTGCCCTTCAGAGTAGCCTCACCATTAGTGGCAGCATC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.