Search our product database

Search options:
Product name: hHNRNPM €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09877-1
Sigma Product ID: EHU098771
Species: Homo sapiens
Ensembl Gene ID: ENSG00000099783
Ensembl Transcript ID: ENST00000325495, ENST00000348943, ENST00000594907, ENST00000596984, ENST00000600092, ENST00000600806, ENST00000620401
Gene coordinates (GRCh38): 19:8444767-8489114
HGNC Alias: CEAR, HNRNPM4, HNRPM, HNRPM4, HTGR1, NAGR1
HGNC ID: HGNC:5046
HGNC Symbol: HNRNPM
NCBI gene: 4670
RefSeq mRNA: NM_001297418, NM_005968, NM_031203
Sequence:GCTGGAAGACTTGGAAGCACAGTATTTGTAGCAAATCTGGATTATAAAGTTGGCT
GGAAGAAACTGAAGGAAGTATTTAGTATGGCTGGTGTGGTGGTCCGAGCAGACAT
TCTTGAAGATAAAGATGGAAAAAGTCGTGGAATAGGCACTGTTACTTTTGAACAG
TCCATTGAAGCTGTGCAAGCTATATCTATGTTCAATGGCCAGCTGCTATTTGATA
GACCAATGCACGTCAAGATGGATGAGAGGGCCTT
Product name: hHNRNPM €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09877-1
Sigma Product ID: EHU098771
Species: Homo sapiens
Ensembl Gene ID: ENSG00000099783
Ensembl Transcript ID: ENST00000325495, ENST00000348943, ENST00000594907, ENST00000596984, ENST00000600092, ENST00000600806, ENST00000620401
Gene coordinates (GRCh38): 19:8444767-8489114
HGNC Alias: CEAR, HNRNPM4, HNRPM, HNRPM4, HTGR1, NAGR1
HGNC ID: HGNC:5046
HGNC Symbol: HNRNPM
NCBI gene: 4670
RefSeq mRNA: NM_001297418, NM_005968, NM_031203
Sequence:GCTGGAAGACTTGGAAGCACAGTATTTGTAGCAAATCTGGATTATAAAGTTGGCT
GGAAGAAACTGAAGGAAGTATTTAGTATGGCTGGTGTGGTGGTCCGAGCAGACAT
TCTTGAAGATAAAGATGGAAAAAGTCGTGGAATAGGCACTGTTACTTTTGAACAG
TCCATTGAAGCTGTGCAAGCTATATCTATGTTCAATGGCCAGCTGCTATTTGATA
GACCAATGCACGTCAAGATGGATGAGAGGGCCTT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.