Search our product database

Search options:
Product name: hPTRHD1 (2) €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10059-1
Sigma Product ID: EHU100591
Species: Homo sapiens
Ensembl Gene ID: ENSG00000184924
Ensembl Transcript ID: ENST00000328379
Gene coordinates (GRCh38): 2:24789734-24793382
HGNC Alias: C2orf79, LOC391356
HGNC ID: HGNC:33782
HGNC Symbol: PTRHD1
NCBI gene: 391356
RefSeq mRNA: NM_001013663
Sequence:ATCACAAGCTCCGTTCTCCTGGCCGGCGGGCGCACTGGTAGCGCAGGCTTGTCAC
GCGGCCACCGCGGCCTTGCACACTCACCGCGACCACCCGCACACAGCCGCTTACC
TCCAAGAGCTGGGGCGCATGCGCAAAGTGGTCCTCGAGGCCCCAGATGAGACCAC
CCTAAAGGAGCTGGCCGAGACCCTGCAACAGAAGAACATTGACCACATGCTGTGG
Product name: hPTRHD1 (2) €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10059-1
Sigma Product ID: EHU100591
Species: Homo sapiens
Ensembl Gene ID: ENSG00000184924
Ensembl Transcript ID: ENST00000328379
Gene coordinates (GRCh38): 2:24789734-24793382
HGNC Alias: C2orf79, LOC391356
HGNC ID: HGNC:33782
HGNC Symbol: PTRHD1
NCBI gene: 391356
RefSeq mRNA: NM_001013663
Sequence:ATCACAAGCTCCGTTCTCCTGGCCGGCGGGCGCACTGGTAGCGCAGGCTTGTCAC
GCGGCCACCGCGGCCTTGCACACTCACCGCGACCACCCGCACACAGCCGCTTACC
TCCAAGAGCTGGGGCGCATGCGCAAAGTGGTCCTCGAGGCCCCAGATGAGACCAC
CCTAAAGGAGCTGGCCGAGACCCTGCAACAGAAGAACATTGACCACATGCTGTGG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.