Search our product database

Search options:
Product name: hTGM2 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10071-1
Sigma Product ID: EHU100711
Species: Homo sapiens
Ensembl Gene ID: ENSG00000198959
Ensembl Transcript ID: ENST00000361475
Gene coordinates (GRCh38): 20:38127387-38166578
HGNC Alias: TGC
HGNC ID: HGNC:11778
HGNC Symbol: TGM2
NCBI gene: 7052
RefSeq mRNA: NM_001323316, NM_001323317, NM_001323318, NM_004613, NM_198951
Sequence:AGAGCATGAACATGGGCAGTGACTTTGACGTCTTTGCCCACATCACCAACAACAC
CGCTGAGGAGTACGTCTGCCGCCTCCTGCTCTGTGCCCGCACCGTCAGCTACAAT
GGGATCTTGGGGCCCGAGTGTGGCACCAAGTACCTGCTCAACCTCAACCTGGAGC
CTTTCTCTGAGAAGAGCGTTCCTCTTTGCATCCTCTATGAGAAATACCGTGACTG
CCTTACGG
Product name: hTGM2 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10071-1
Sigma Product ID: EHU100711
Species: Homo sapiens
Ensembl Gene ID: ENSG00000198959
Ensembl Transcript ID: ENST00000361475
Gene coordinates (GRCh38): 20:38127387-38166578
HGNC Alias: TGC
HGNC ID: HGNC:11778
HGNC Symbol: TGM2
NCBI gene: 7052
RefSeq mRNA: NM_001323316, NM_001323317, NM_001323318, NM_004613, NM_198951
Sequence:AGAGCATGAACATGGGCAGTGACTTTGACGTCTTTGCCCACATCACCAACAACAC
CGCTGAGGAGTACGTCTGCCGCCTCCTGCTCTGTGCCCGCACCGTCAGCTACAAT
GGGATCTTGGGGCCCGAGTGTGGCACCAAGTACCTGCTCAACCTCAACCTGGAGC
CTTTCTCTGAGAAGAGCGTTCCTCTTTGCATCCTCTATGAGAAATACCGTGACTG
CCTTACGG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.