Search our product database

Search options:
Product name: hHMGB2 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10587-1
Sigma Product ID: EHU105871
Species: Homo sapiens
Ensembl Gene ID: ENSG00000164104
Ensembl Transcript ID: ENST00000296503, ENST00000438704, ENST00000446922, ENST00000511316
Gene coordinates (GRCh38): 4:173331695-173335125
HGNC Alias: HMG2
HGNC ID: HGNC:5000
HGNC Symbol: HMGB2
NCBI gene: 3148
RefSeq mRNA: NM_001130688, NM_001130689, NM_002129
Sequence:TTACGTTCCTCCCAAAGGTGATAAGAAGGGGAAGAAAAAGGACCCCAATGCTCCT
AAAAGGCCACCATCTGCCTTCTTCCTGTTTTGCTCTGAACATCGCCCAAAGATCA
AAAGTGAACACCCTGGCCTATCCATTGGGGATACTGCAAAGAAATTGGGTGAAAT
GTGGTCTGAGCAGTCAGCCAAAGATAAACAACCATATGAACAGAAAGCAGCTAAG
CTAAAGGAGAAATATGAAAAGGATATTGCTGCATATCGTGCCAAGGGCAAAAGTG
AAGCAGGAAAGAAGGGCCCTGGCAGGCCAACAGGCTCAAAGAAGAAGAACGAACC
AGAAGATGAGGAGGAGGAGGAGGAAGAAGAAGATGAAGATGAGGAGGAAGAGGAT
GAAGATGAAGAATAAATGGCTATCCTTTAATGATGCGTGTGGAATGTGT
Product name: hHMGB2 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10587-1
Sigma Product ID: EHU105871
Species: Homo sapiens
Ensembl Gene ID: ENSG00000164104
Ensembl Transcript ID: ENST00000296503, ENST00000438704, ENST00000446922, ENST00000511316
Gene coordinates (GRCh38): 4:173331695-173335125
HGNC Alias: HMG2
HGNC ID: HGNC:5000
HGNC Symbol: HMGB2
NCBI gene: 3148
RefSeq mRNA: NM_001130688, NM_001130689, NM_002129
Sequence:TTACGTTCCTCCCAAAGGTGATAAGAAGGGGAAGAAAAAGGACCCCAATGCTCCT
AAAAGGCCACCATCTGCCTTCTTCCTGTTTTGCTCTGAACATCGCCCAAAGATCA
AAAGTGAACACCCTGGCCTATCCATTGGGGATACTGCAAAGAAATTGGGTGAAAT
GTGGTCTGAGCAGTCAGCCAAAGATAAACAACCATATGAACAGAAAGCAGCTAAG
CTAAAGGAGAAATATGAAAAGGATATTGCTGCATATCGTGCCAAGGGCAAAAGTG
AAGCAGGAAAGAAGGGCCCTGGCAGGCCAACAGGCTCAAAGAAGAAGAACGAACC
AGAAGATGAGGAGGAGGAGGAGGAAGAAGAAGATGAAGATGAGGAGGAAGAGGAT
GAAGATGAAGAATAAATGGCTATCCTTTAATGATGCGTGTGGAATGTGT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.