Search our product database

Search options:
Product name: hPPIA €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10710-1
Sigma Product ID: EHU107101
Species: Homo sapiens
Ensembl Gene ID: ENSG00000196262
Ensembl Transcript ID: ENST00000468812
Gene coordinates (GRCh38): 7:44796680-44824564
HGNC Alias: CYPA
HGNC ID: HGNC:9253
HGNC Symbol: PPIA
NCBI gene: 5478
RefSeq mRNA: NM_021130
Sequence:TGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCTT
TGGGTCCAGGAATGGCAAGACCAGCAAGAAGATCACCATTGCTGACTGTGGACAA
CTCGAATAAGTTTGACTTGTGTTTTATCTTAACCACCAGATCATTCCTTCTGTAG
CTCAGGAGAGCACCCCTCCACCCCATTTGCTCGCAGTATCCTAGAATCTTTGTGC
TCTCGCTGCAGTTCCCTTTGGGTTCCATGTTTTCCTTGTTCCCTCCCATGCCTAG
CTGGATTGCAGAGTTAAGTTTATGATTATGAAATAAAAACTAAATAACAATTGTC
CTCGTTTGAGTTAAGAGTGTTGATGTAGGCTTTATTTTAAGCAGTAATGGGTTAC
TTCTGAAACATCACTTGTTTGCTTAATTCTACACAGTACTTAGATTTTTTTTACT
TTCCAGTCCCAGGAAGTGTCAATGTTTGTTGAGTGGAATATTGAAAATGTAGGCA
GCAACTGGG
Product name: hPPIA €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10710-1
Sigma Product ID: EHU107101
Species: Homo sapiens
Ensembl Gene ID: ENSG00000196262
Ensembl Transcript ID: ENST00000468812
Gene coordinates (GRCh38): 7:44796680-44824564
HGNC Alias: CYPA
HGNC ID: HGNC:9253
HGNC Symbol: PPIA
NCBI gene: 5478
RefSeq mRNA: NM_021130
Sequence:TGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCTT
TGGGTCCAGGAATGGCAAGACCAGCAAGAAGATCACCATTGCTGACTGTGGACAA
CTCGAATAAGTTTGACTTGTGTTTTATCTTAACCACCAGATCATTCCTTCTGTAG
CTCAGGAGAGCACCCCTCCACCCCATTTGCTCGCAGTATCCTAGAATCTTTGTGC
TCTCGCTGCAGTTCCCTTTGGGTTCCATGTTTTCCTTGTTCCCTCCCATGCCTAG
CTGGATTGCAGAGTTAAGTTTATGATTATGAAATAAAAACTAAATAACAATTGTC
CTCGTTTGAGTTAAGAGTGTTGATGTAGGCTTTATTTTAAGCAGTAATGGGTTAC
TTCTGAAACATCACTTGTTTGCTTAATTCTACACAGTACTTAGATTTTTTTTACT
TTCCAGTCCCAGGAAGTGTCAATGTTTGTTGAGTGGAATATTGAAAATGTAGGCA
GCAACTGGG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.