Search our product database

Search options:
Product name: hRCC2 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10763-1
Sigma Product ID: EHU107631
Species: Homo sapiens
Ensembl Gene ID: ENSG00000179051
Ensembl Transcript ID: ENST00000375433, ENST00000375436
Gene coordinates (GRCh38): 1:17406760-17439724
HGNC Alias: TD-60
HGNC ID: HGNC:30297
HGNC Symbol: RCC2
NCBI gene: 55920
RefSeq mRNA: NM_001136204, NM_018715
Sequence:CAGCTGGGACACAACTCAGATGGGAAGTTCATCGCCCGGGCACAGCGGATAGAGT
ACGACTGTGAACTAGTTCCCCGGCGAGTGGCCATCTTCATTGAGAAGACGAAAGA
TGGACAGATTCTGCCTGTACCAAACGTGGTTGTACGAGACGTGGCCTGTGGCGCT
AACCACACGCTGGTCCTGGACTCCCAGAAGCGAGTCTTCTCCTGGGGCTTTGGTG
GCTATGGCCGGCTGGGCCACGCAGAGCAGAAGGATGAGATGGTCCCCCGCCTGGT
GAAGCTGTTTGACTTCCCTGGGCGTGGGGCTTCCCAGATCTATGCTGGTTACACC
TGCTCCTTTGCTGTCAGTGAAGTGGGTGGTCTGTTTTTCTGGGGGGCCACCAACA
CCTCCCGTGAATCTACCATGTACCCAAAAGCAGTGCAG
Product name: hRCC2 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10763-1
Sigma Product ID: EHU107631
Species: Homo sapiens
Ensembl Gene ID: ENSG00000179051
Ensembl Transcript ID: ENST00000375433, ENST00000375436
Gene coordinates (GRCh38): 1:17406760-17439724
HGNC Alias: TD-60
HGNC ID: HGNC:30297
HGNC Symbol: RCC2
NCBI gene: 55920
RefSeq mRNA: NM_001136204, NM_018715
Sequence:CAGCTGGGACACAACTCAGATGGGAAGTTCATCGCCCGGGCACAGCGGATAGAGT
ACGACTGTGAACTAGTTCCCCGGCGAGTGGCCATCTTCATTGAGAAGACGAAAGA
TGGACAGATTCTGCCTGTACCAAACGTGGTTGTACGAGACGTGGCCTGTGGCGCT
AACCACACGCTGGTCCTGGACTCCCAGAAGCGAGTCTTCTCCTGGGGCTTTGGTG
GCTATGGCCGGCTGGGCCACGCAGAGCAGAAGGATGAGATGGTCCCCCGCCTGGT
GAAGCTGTTTGACTTCCCTGGGCGTGGGGCTTCCCAGATCTATGCTGGTTACACC
TGCTCCTTTGCTGTCAGTGAAGTGGGTGGTCTGTTTTTCTGGGGGGCCACCAACA
CCTCCCGTGAATCTACCATGTACCCAAAAGCAGTGCAG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.