Search our product database

Search options:
Product name: hSNW1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10771-1
Sigma Product ID: EHU107711
Species: Homo sapiens
Ensembl Gene ID: ENSG00000100603
Ensembl Transcript ID: ENST00000261531, ENST00000554775, ENST00000555761, ENST00000556428
Gene coordinates (GRCh38): 14:77717599-77761207
HGNC Alias: Bx42, FUN20, NCoA-62, Prp45, PRPF45, SKIIP, SKIP, SKIP1
HGNC ID: HGNC:16696
HGNC Symbol: SNW1
NCBI gene: 22938
RefSeq mRNA: NM_001318844, NM_012245
Sequence:ATGATCCAGACCTGCAAAGGCCCGATGAAGAAGCTATTAAAGAGATAACAGAAAA
GACAAGAGTAGCCTTAGAAAAATCTGTATCACAGAAGGTCGCCGCAGCCATGCCA
GTTCGAGCAGCTGACAAATTGGCTCCTGCTCAGTATATCCGATACACACCATCTC
AGCAAGGAGTGGCATTCAACTCTGGAGCTAAACAGAGGGTTATTCGGATGGTAGA
AATGCAGAAAGATCCAATGGAGCCTCCAAGGTTCAAGATTAATAAGAAAATTCCC
CGGGGACCACCTTCTCCTCCTGCGCCTGTCATGCATTCTCCTAGCCGAAAGATGA
CTGTAAAGGAACAACAAGAGTGGAAGATTCCTCCTTGTATTTCTAACTGGAAAAA
TGCAAAGGGTTATACAATTCCATTAGACAAACGTCTGGCTGCTGATGGAAGAGGA
CTACAGACAGTACACATAAATGAAAATTTCGCCAAATTGGCAGAAGCCCTCTACA
Product name: hSNW1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10771-1
Sigma Product ID: EHU107711
Species: Homo sapiens
Ensembl Gene ID: ENSG00000100603
Ensembl Transcript ID: ENST00000261531, ENST00000554775, ENST00000555761, ENST00000556428
Gene coordinates (GRCh38): 14:77717599-77761207
HGNC Alias: Bx42, FUN20, NCoA-62, Prp45, PRPF45, SKIIP, SKIP, SKIP1
HGNC ID: HGNC:16696
HGNC Symbol: SNW1
NCBI gene: 22938
RefSeq mRNA: NM_001318844, NM_012245
Sequence:ATGATCCAGACCTGCAAAGGCCCGATGAAGAAGCTATTAAAGAGATAACAGAAAA
GACAAGAGTAGCCTTAGAAAAATCTGTATCACAGAAGGTCGCCGCAGCCATGCCA
GTTCGAGCAGCTGACAAATTGGCTCCTGCTCAGTATATCCGATACACACCATCTC
AGCAAGGAGTGGCATTCAACTCTGGAGCTAAACAGAGGGTTATTCGGATGGTAGA
AATGCAGAAAGATCCAATGGAGCCTCCAAGGTTCAAGATTAATAAGAAAATTCCC
CGGGGACCACCTTCTCCTCCTGCGCCTGTCATGCATTCTCCTAGCCGAAAGATGA
CTGTAAAGGAACAACAAGAGTGGAAGATTCCTCCTTGTATTTCTAACTGGAAAAA
TGCAAAGGGTTATACAATTCCATTAGACAAACGTCTGGCTGCTGATGGAAGAGGA
CTACAGACAGTACACATAAATGAAAATTTCGCCAAATTGGCAGAAGCCCTCTACA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.