Search our product database

Search options:
Product name: hMSX2 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10792-1
Sigma Product ID: EHU107921
Species: Homo sapiens
Ensembl Gene ID: ENSG00000120149
Ensembl Transcript ID: ENST00000239243, ENST00000507785
Gene coordinates (GRCh38): 5:174724533-174730893
HGNC Alias: CRS2, FPP, HOX8, MSH, PFM, PFM1
HGNC ID: HGNC:7392
HGNC Symbol: MSX2
NCBI gene: 4488
RefSeq mRNA: NM_002449
Sequence:TTACCACATCCCAGCTCCTCGCCCTGGAGCGCAAGTTCCGTCAGAAACAGTACCT
CTCCATTGCAGAGCGTGCAGAGTTCTCCAGCTCTCTGAACCTCACAGAGACCCAG
GTCAAAATCTGGTTCCAGAACCGAAGGGCCAAGGCGAAAAGACTGCAGGAGGCAG
AACTGGAAAAGCTGAAAATGGCTGCAAAACCTATGCTGCCCTCCAGCTTCAGTCT
CCCTTTCCCCATCAGCTCGCCCCTGCAGGCAGCGTCCATATATGGAGCATCCTAC
CCGTTCCATAGACCTGTGCTTCCCATCCCGCCTGTGGGACTCTATGCCACGCCAG
TGGGATATGGCATGTACCACCTGTCCTAAGGAAGACCAGATCAATAGACTCCATG
ATGGATGCTTGTTTCAAAGGGTTTCCTCTCCCTC
Product name: hMSX2 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10792-1
Sigma Product ID: EHU107921
Species: Homo sapiens
Ensembl Gene ID: ENSG00000120149
Ensembl Transcript ID: ENST00000239243, ENST00000507785
Gene coordinates (GRCh38): 5:174724533-174730893
HGNC Alias: CRS2, FPP, HOX8, MSH, PFM, PFM1
HGNC ID: HGNC:7392
HGNC Symbol: MSX2
NCBI gene: 4488
RefSeq mRNA: NM_002449
Sequence:TTACCACATCCCAGCTCCTCGCCCTGGAGCGCAAGTTCCGTCAGAAACAGTACCT
CTCCATTGCAGAGCGTGCAGAGTTCTCCAGCTCTCTGAACCTCACAGAGACCCAG
GTCAAAATCTGGTTCCAGAACCGAAGGGCCAAGGCGAAAAGACTGCAGGAGGCAG
AACTGGAAAAGCTGAAAATGGCTGCAAAACCTATGCTGCCCTCCAGCTTCAGTCT
CCCTTTCCCCATCAGCTCGCCCCTGCAGGCAGCGTCCATATATGGAGCATCCTAC
CCGTTCCATAGACCTGTGCTTCCCATCCCGCCTGTGGGACTCTATGCCACGCCAG
TGGGATATGGCATGTACCACCTGTCCTAAGGAAGACCAGATCAATAGACTCCATG
ATGGATGCTTGTTTCAAAGGGTTTCCTCTCCCTC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.