Search our product database

Search options:
Product name: hSTAT5A €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10815-1
Sigma Product ID: EHU108151
Species: Homo sapiens
Ensembl Gene ID: ENSG00000126561
Ensembl Transcript ID: ENST00000345506, ENST00000546010, ENST00000588868, ENST00000590949
Gene coordinates (GRCh38): 17:42287547-42311943
HGNC Alias: MGF, STAT5
HGNC ID: HGNC:11366
HGNC Symbol: STAT5A
NCBI gene: 6776
RefSeq mRNA: NM_001288718, NM_001288719, NM_001288720, NM_003152
Sequence:CCTGTGGAACCTGAAACCATTCACCACGCGGGATTTCTCCATCAGGTCCCTGGCT
GACCGGCTGGGGGACCTGAGCTATCTCATCTATGTGTTTCCTGACCGCCCCAAGG
ATGAGGTCTTCTCCAAGTACTACACTCCTGTGCTGGCTAAAGCTGTTGATGGATA
TGTGAAACCACAGATCAAGCAAGTGGTCCCTGAGTTTGTGAATGCATCTGCAGAT
GCTGGGGGCAGCAGCGCCACGTACATGGACCAGGCCCCCTCCCCAGCTGTGTGCC
CCCAGGCTCCCTATAACATGTACCCACAGAACCCTGACCATGTACTCGATCAGGA
TGGAGAATTCGACCTGGATGAGACCATGGATGTGGCCAGGCACGTGGAGGAACTC
TTACGCCGACCAATGGACAGTCTTGACTCCCGCCTCTCGCCCCCTGCCGGTCTTT
TCACCTCTGCCAGAGGCTCCCTCTCATGAATGTTTGAATCCCACGCT
Product name: hSTAT5A €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10815-1
Sigma Product ID: EHU108151
Species: Homo sapiens
Ensembl Gene ID: ENSG00000126561
Ensembl Transcript ID: ENST00000345506, ENST00000546010, ENST00000588868, ENST00000590949
Gene coordinates (GRCh38): 17:42287547-42311943
HGNC Alias: MGF, STAT5
HGNC ID: HGNC:11366
HGNC Symbol: STAT5A
NCBI gene: 6776
RefSeq mRNA: NM_001288718, NM_001288719, NM_001288720, NM_003152
Sequence:CCTGTGGAACCTGAAACCATTCACCACGCGGGATTTCTCCATCAGGTCCCTGGCT
GACCGGCTGGGGGACCTGAGCTATCTCATCTATGTGTTTCCTGACCGCCCCAAGG
ATGAGGTCTTCTCCAAGTACTACACTCCTGTGCTGGCTAAAGCTGTTGATGGATA
TGTGAAACCACAGATCAAGCAAGTGGTCCCTGAGTTTGTGAATGCATCTGCAGAT
GCTGGGGGCAGCAGCGCCACGTACATGGACCAGGCCCCCTCCCCAGCTGTGTGCC
CCCAGGCTCCCTATAACATGTACCCACAGAACCCTGACCATGTACTCGATCAGGA
TGGAGAATTCGACCTGGATGAGACCATGGATGTGGCCAGGCACGTGGAGGAACTC
TTACGCCGACCAATGGACAGTCTTGACTCCCGCCTCTCGCCCCCTGCCGGTCTTT
TCACCTCTGCCAGAGGCTCCCTCTCATGAATGTTTGAATCCCACGCT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.