Search our product database

Search options:
Product name: hLAP3 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10825-1
Sigma Product ID: EHU108251
Species: Homo sapiens
Ensembl Gene ID: ENSG00000002549
Ensembl Transcript ID: ENST00000226299, ENST00000503467, ENST00000606142, ENST00000618908
Gene coordinates (GRCh38): 4:17577192-17607972
HGNC Alias: LAP, LAPEP, PEPS
HGNC ID: HGNC:18449
HGNC Symbol: LAP3
NCBI gene: 51056
RefSeq mRNA: NM_015907
Sequence:GGTGCCATGGATGTAGCTTTGGGATCAGGTGCCACTGGGGTCTTTACCAATTCAT
CCTGGCTCTGGAACAAACTCTTCGAGGCCAGCATTGAAACAGGGGACCGTGTCTG
GAGGATGCCTCTCTTCGAACATTATACAAGACAGGTTGTAGATTGCCAGCTTGCT
GATGTTAACAACATTGGAAAATACAGATCTGCAGGAGCATGTACAGCTGCAGCAT
TCCTGAAAGAATTCGTAACTCATCCTAAGTGGGCACATTTAGACATAGCAGGCGT
GATGACCAACAAAGATGAAGTTCCCTATCTACGGAAAGGCATGACTGGGAGGCCC
ACAAGGACTCTCATTGAGTTCTTACTTCGTTTCAGTCAAGACAATGCTTAGTTCA
GATACTCAAAAATGTCTTCACTCTGTCTTAAATTGGACAGTTGAACTTAAAAGGT
TTTTGAATAAATGGATGAAAATCTTTTAACGGAGACAAAGGATGG
Product name: hLAP3 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10825-1
Sigma Product ID: EHU108251
Species: Homo sapiens
Ensembl Gene ID: ENSG00000002549
Ensembl Transcript ID: ENST00000226299, ENST00000503467, ENST00000606142, ENST00000618908
Gene coordinates (GRCh38): 4:17577192-17607972
HGNC Alias: LAP, LAPEP, PEPS
HGNC ID: HGNC:18449
HGNC Symbol: LAP3
NCBI gene: 51056
RefSeq mRNA: NM_015907
Sequence:GGTGCCATGGATGTAGCTTTGGGATCAGGTGCCACTGGGGTCTTTACCAATTCAT
CCTGGCTCTGGAACAAACTCTTCGAGGCCAGCATTGAAACAGGGGACCGTGTCTG
GAGGATGCCTCTCTTCGAACATTATACAAGACAGGTTGTAGATTGCCAGCTTGCT
GATGTTAACAACATTGGAAAATACAGATCTGCAGGAGCATGTACAGCTGCAGCAT
TCCTGAAAGAATTCGTAACTCATCCTAAGTGGGCACATTTAGACATAGCAGGCGT
GATGACCAACAAAGATGAAGTTCCCTATCTACGGAAAGGCATGACTGGGAGGCCC
ACAAGGACTCTCATTGAGTTCTTACTTCGTTTCAGTCAAGACAATGCTTAGTTCA
GATACTCAAAAATGTCTTCACTCTGTCTTAAATTGGACAGTTGAACTTAAAAGGT
TTTTGAATAAATGGATGAAAATCTTTTAACGGAGACAAAGGATGG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.