Search our product database

Search options:
Product name: hVDAC3 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10873-1
Sigma Product ID: EHU108731
Species: Homo sapiens
Ensembl Gene ID: ENSG00000078668
Ensembl Transcript ID: ENST00000022615, ENST00000521158, ENST00000521348
Gene coordinates (GRCh38): 8:42391624-42405897
HGNC Alias: HD-VDAC3
HGNC ID: HGNC:12674
HGNC Symbol: VDAC3
NCBI gene: 7419
RefSeq mRNA: NM_001135694, NM_005662
Sequence:GGAAAGCATCAGGCAACCTAGAAACCAAATATAAGGTCTGTAACTATGGACTTAC
CTTCACCCAGAAATGGAACACAGACAATACTCTAGGGACAGAAATCTCTTGGGAG
AATAAGTTGGCTGAAGGGTTGAAACTGACTCTTGATACCATATTTGTACCGAACA
CAGGAAAGAAGAGTGGGAAATTGAAGGCCTCCTATAAACGGGATTGTTTTAGTGT
TGGCAGTAATGTTGATATAGATTTTTCTGGACCAACCATCTATGGCTGGGCTGTG
TTGGCCTTCGAAGGGTGGCTTGCTGGCTATCAGATGAGTTTTGACACAGCCAAAT
CCAAACTGTCACAGAATAATTTCGCCCTGGGTTACAAGGCTGCGGACTTCCAGCT
GCACACACATGTGAACGATGGCACTGAAT
Product name: hVDAC3 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10873-1
Sigma Product ID: EHU108731
Species: Homo sapiens
Ensembl Gene ID: ENSG00000078668
Ensembl Transcript ID: ENST00000022615, ENST00000521158, ENST00000521348
Gene coordinates (GRCh38): 8:42391624-42405897
HGNC Alias: HD-VDAC3
HGNC ID: HGNC:12674
HGNC Symbol: VDAC3
NCBI gene: 7419
RefSeq mRNA: NM_001135694, NM_005662
Sequence:GGAAAGCATCAGGCAACCTAGAAACCAAATATAAGGTCTGTAACTATGGACTTAC
CTTCACCCAGAAATGGAACACAGACAATACTCTAGGGACAGAAATCTCTTGGGAG
AATAAGTTGGCTGAAGGGTTGAAACTGACTCTTGATACCATATTTGTACCGAACA
CAGGAAAGAAGAGTGGGAAATTGAAGGCCTCCTATAAACGGGATTGTTTTAGTGT
TGGCAGTAATGTTGATATAGATTTTTCTGGACCAACCATCTATGGCTGGGCTGTG
TTGGCCTTCGAAGGGTGGCTTGCTGGCTATCAGATGAGTTTTGACACAGCCAAAT
CCAAACTGTCACAGAATAATTTCGCCCTGGGTTACAAGGCTGCGGACTTCCAGCT
GCACACACATGTGAACGATGGCACTGAAT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.