Search our product database

Search options:
Product name: hANAPC10 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10880-1
Sigma Product ID: EHU108801
Species: Homo sapiens
Ensembl Gene ID: ENSG00000164162
Ensembl Transcript ID: ENST00000309439, ENST00000451299, ENST00000507656, ENST00000510270, ENST00000513054, ENST00000514390, ENST00000613466
Gene coordinates (GRCh38): 4:144831908-145098541
HGNC Alias: APC10, DKFZP564L0562, DOC1
HGNC ID: HGNC:24077
HGNC Symbol: ANAPC10
NCBI gene: 10393
RefSeq mRNA: NM_001256706, NM_001256707, NM_001256708, NM_001256709, NM_001318367, NM_014885
Sequence:GCAGTTGGAAAGGACTGGAACAGTACGGGAAATTGGGTCACAAGCTGTTTGGTCA
CTCTCATCTTGCAAACCAGGATTTGGAGTGGATCAGTTACGAGATGACAATCTAG
AAACTTATTGGCAATCAGATGGTTCCCAGCCTCATTTAGTGAACATCCAATTCAG
AAGAAAAACAACAGTGAAGACATTATGTATTTATGCAGACTACAAATCTGATGAA
AGCTATACTCCAAGCAAGATCTCAGTCAGAGTAGGAAATAATTTTCACAACCTTC
AAGAAATTCGGCAACTTGAGTTGGTGGAACCAAGTGGCTGGATTCATGTTCCCTT
AACTGACAATCATAAGAAGCCAACTCGTACATTCATGATACAGATTGCTGTTCTA
GCCAATCACCAGAATGGAAGAGACACCC
Product name: hANAPC10 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10880-1
Sigma Product ID: EHU108801
Species: Homo sapiens
Ensembl Gene ID: ENSG00000164162
Ensembl Transcript ID: ENST00000309439, ENST00000451299, ENST00000507656, ENST00000510270, ENST00000513054, ENST00000514390, ENST00000613466
Gene coordinates (GRCh38): 4:144831908-145098541
HGNC Alias: APC10, DKFZP564L0562, DOC1
HGNC ID: HGNC:24077
HGNC Symbol: ANAPC10
NCBI gene: 10393
RefSeq mRNA: NM_001256706, NM_001256707, NM_001256708, NM_001256709, NM_001318367, NM_014885
Sequence:GCAGTTGGAAAGGACTGGAACAGTACGGGAAATTGGGTCACAAGCTGTTTGGTCA
CTCTCATCTTGCAAACCAGGATTTGGAGTGGATCAGTTACGAGATGACAATCTAG
AAACTTATTGGCAATCAGATGGTTCCCAGCCTCATTTAGTGAACATCCAATTCAG
AAGAAAAACAACAGTGAAGACATTATGTATTTATGCAGACTACAAATCTGATGAA
AGCTATACTCCAAGCAAGATCTCAGTCAGAGTAGGAAATAATTTTCACAACCTTC
AAGAAATTCGGCAACTTGAGTTGGTGGAACCAAGTGGCTGGATTCATGTTCCCTT
AACTGACAATCATAAGAAGCCAACTCGTACATTCATGATACAGATTGCTGTTCTA
GCCAATCACCAGAATGGAAGAGACACCC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.