Search our product database

Search options:
Product name: hRAD21 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10891-1
Sigma Product ID: EHU108911
Species: Homo sapiens
Ensembl Gene ID: ENSG00000164754
Ensembl Transcript ID: ENST00000297338
Gene coordinates (GRCh38): 8:116845935-116874866
HGNC Alias: hHR21, KIAA0078, SCC1
HGNC ID: HGNC:9811
HGNC Symbol: RAD21
NCBI gene: 5885
RefSeq mRNA: NM_006265
Sequence:TGATGGCGGTATCTTTGATGATCCCCCTGCCCTCTCTGAGGCAGGGGTGATGTTG
CCAGAGCAGCCTGCACATGACGATATGGATGAGGATGATAATGTATCAATGGGTG
GGCCTGATAGTCCTGATTCAGTGGATCCCGTTGAACCAATGCCAACCATGACTGA
TCAAACAACACTTGTTCCAAATGAGGAAGAAGCATTTGCATTGGAGCCTATTGAT
ATAACTGTTAAAGAAACAAAAGCCAAGAGGAAGAGGAAGCTAATTGTTGACAGTG
TCAAAGAGTTGGATAGCAAGACAATTAGAGCCCAACTTAGTGATTATTCAGATAT
TGTTACTACTTTGGATCTGGCACCGCCCACCAAGAAATTGATGATGTGGAAAGAG
ACAGGAGGAGTAGAAAAACTGTTTTCTTTACCTGCTCAGCCTTTGTGGAATAACA
GACTACTGAAGCTCTTTACACGCTGTCTTACACCGC
Product name: hRAD21 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10891-1
Sigma Product ID: EHU108911
Species: Homo sapiens
Ensembl Gene ID: ENSG00000164754
Ensembl Transcript ID: ENST00000297338
Gene coordinates (GRCh38): 8:116845935-116874866
HGNC Alias: hHR21, KIAA0078, SCC1
HGNC ID: HGNC:9811
HGNC Symbol: RAD21
NCBI gene: 5885
RefSeq mRNA: NM_006265
Sequence:TGATGGCGGTATCTTTGATGATCCCCCTGCCCTCTCTGAGGCAGGGGTGATGTTG
CCAGAGCAGCCTGCACATGACGATATGGATGAGGATGATAATGTATCAATGGGTG
GGCCTGATAGTCCTGATTCAGTGGATCCCGTTGAACCAATGCCAACCATGACTGA
TCAAACAACACTTGTTCCAAATGAGGAAGAAGCATTTGCATTGGAGCCTATTGAT
ATAACTGTTAAAGAAACAAAAGCCAAGAGGAAGAGGAAGCTAATTGTTGACAGTG
TCAAAGAGTTGGATAGCAAGACAATTAGAGCCCAACTTAGTGATTATTCAGATAT
TGTTACTACTTTGGATCTGGCACCGCCCACCAAGAAATTGATGATGTGGAAAGAG
ACAGGAGGAGTAGAAAAACTGTTTTCTTTACCTGCTCAGCCTTTGTGGAATAACA
GACTACTGAAGCTCTTTACACGCTGTCTTACACCGC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.