Search our product database

Search options:
Product name: hRNF2 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10906-1
Sigma Product ID: EHU109061
Species: Homo sapiens
Ensembl Gene ID: ENSG00000121481
Ensembl Transcript ID: ENST00000367510, ENST00000453650
Gene coordinates (GRCh38): 1:185045364-185102608
HGNC Alias: BAP-1, BAP1, DING, HIPI3, RING1B, RING2
HGNC ID: HGNC:10061
HGNC Symbol: RNF2
NCBI gene: 6045
RefSeq mRNA: NM_007212
Sequence:CACTAAGGCCAGACCCAAACTTTGATGCACTCATCAGCAAAATTTATCCAAGTCG
TGATGAGTATGAAGCTCATCAAGAGAGAGTATTAGCCAGGATCAACAAGCACAAT
AATCAGCAAGCACTCAGTCACAGCATTGAGGAAGGACTGAAGATACAGGCCATGA
ACAGACTGCAGCGAGGCAAGAAACAACAGATTGAAAATGGTAGTGGAGCAGAAGA
TAATGGTGACAGTTCACACTGCAGTAATGCATCCACACATAGCAATCAGGAAGCA
GGCCCTAGTAACAAACGGACCAAAACATCTGATGATTCTGGGCTAGAGCTTGATA
ATAACAATGCAGCAATGGCAATTGATCCAGTAATGGATGGTGCTAGTGAAATTGA
ATTAGTATTCAGGCCTCATCCCACACTTATGGAAAAAGATGACAGTGCACAGACG
AGATACATAAAGACTTCTGGTAACGCCACTGTTG
Product name: hRNF2 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10906-1
Sigma Product ID: EHU109061
Species: Homo sapiens
Ensembl Gene ID: ENSG00000121481
Ensembl Transcript ID: ENST00000367510, ENST00000453650
Gene coordinates (GRCh38): 1:185045364-185102608
HGNC Alias: BAP-1, BAP1, DING, HIPI3, RING1B, RING2
HGNC ID: HGNC:10061
HGNC Symbol: RNF2
NCBI gene: 6045
RefSeq mRNA: NM_007212
Sequence:CACTAAGGCCAGACCCAAACTTTGATGCACTCATCAGCAAAATTTATCCAAGTCG
TGATGAGTATGAAGCTCATCAAGAGAGAGTATTAGCCAGGATCAACAAGCACAAT
AATCAGCAAGCACTCAGTCACAGCATTGAGGAAGGACTGAAGATACAGGCCATGA
ACAGACTGCAGCGAGGCAAGAAACAACAGATTGAAAATGGTAGTGGAGCAGAAGA
TAATGGTGACAGTTCACACTGCAGTAATGCATCCACACATAGCAATCAGGAAGCA
GGCCCTAGTAACAAACGGACCAAAACATCTGATGATTCTGGGCTAGAGCTTGATA
ATAACAATGCAGCAATGGCAATTGATCCAGTAATGGATGGTGCTAGTGAAATTGA
ATTAGTATTCAGGCCTCATCCCACACTTATGGAAAAAGATGACAGTGCACAGACG
AGATACATAAAGACTTCTGGTAACGCCACTGTTG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.