Search our product database

Search options:
Product name: hNEK2 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10995-1
Sigma Product ID: EHU109951
Species: Homo sapiens
Ensembl Gene ID: ENSG00000117650
Ensembl Transcript ID: ENST00000366998, ENST00000366999, ENST00000462283, ENST00000540251
Gene coordinates (GRCh38): 1:211658657-211675630
HGNC Alias: NEK2A, NLK1, PPP1R111, RP67
HGNC ID: HGNC:7745
HGNC Symbol: NEK2
NCBI gene: 4751
RefSeq mRNA: NM_001204182, NM_001204183, NM_002497
Sequence:GGGCTGCTTGCTGTATGAGTTATGTGCATTAATGCCTCCATTTACAGCTTTTAGC
CAGAAAGAACTCGCTGGGAAAATCAGAGAAGGCAAATTCAGGCGAATTCCATACC
GTTACTCTGATGAATTGAATGAAATTATTACGAGGATGTTAAACTTAAAGGATTA
CCATCGACCTTCTGTTGAAGAAATTCTTGAGAACCCTTTAATAGCAGATTTGGTT
GCAGACGAGCAAAGAAGAAATCTTGAGAGAAGAGGGCGACAATTAGGAGAGCCAG
AAAAATCGCAGGATTCCAGCCCTGTATTGAGTGAGCTGAAACTGAAGGAAATTCA
GTTACAGGAGCGAGAGCGAGCTCTCAAAGCAAGAGAAGAAAGATTGGAGCAGAAA
GAACAGGAGCTTTGTGTTCGTGA
Product name: hNEK2 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10995-1
Sigma Product ID: EHU109951
Species: Homo sapiens
Ensembl Gene ID: ENSG00000117650
Ensembl Transcript ID: ENST00000366998, ENST00000366999, ENST00000462283, ENST00000540251
Gene coordinates (GRCh38): 1:211658657-211675630
HGNC Alias: NEK2A, NLK1, PPP1R111, RP67
HGNC ID: HGNC:7745
HGNC Symbol: NEK2
NCBI gene: 4751
RefSeq mRNA: NM_001204182, NM_001204183, NM_002497
Sequence:GGGCTGCTTGCTGTATGAGTTATGTGCATTAATGCCTCCATTTACAGCTTTTAGC
CAGAAAGAACTCGCTGGGAAAATCAGAGAAGGCAAATTCAGGCGAATTCCATACC
GTTACTCTGATGAATTGAATGAAATTATTACGAGGATGTTAAACTTAAAGGATTA
CCATCGACCTTCTGTTGAAGAAATTCTTGAGAACCCTTTAATAGCAGATTTGGTT
GCAGACGAGCAAAGAAGAAATCTTGAGAGAAGAGGGCGACAATTAGGAGAGCCAG
AAAAATCGCAGGATTCCAGCCCTGTATTGAGTGAGCTGAAACTGAAGGAAATTCA
GTTACAGGAGCGAGAGCGAGCTCTCAAAGCAAGAGAAGAAAGATTGGAGCAGAAA
GAACAGGAGCTTTGTGTTCGTGA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.