Search our product database

Search options:
Product name: hSTRAP €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-11102-1
Sigma Product ID: EHU111021
Species: Homo sapiens
Ensembl Gene ID: ENSG00000023734
Ensembl Transcript ID: ENST00000025399, ENST00000419869, ENST00000541731
Gene coordinates (GRCh38): 12:15882391-15903478
HGNC Alias: MAWD, pt-wd, UNRIP
HGNC ID: HGNC:30796
HGNC Symbol: STRAP
NCBI gene: 11171
RefSeq mRNA: NM_007178
Sequence:TGCAACCATCAATTCTGCATCTCTTCATCCTGAGAAAGAATTTCTTGTTGCAGGC
GGTGAAGATTTTAAACTTTATAAGTATGATTATAATAGTGGAGAAGAATTAGAAT
CCTACAAGGGACACTTTGGTCCTATTCACTGTGTGAGATTTAGTCCTGATGGAGA
ACTCTATGCCAGTGGTTCAGAAGATGGAACATTGAGACTATGGCAAACTGTGGTA
GGAAAAACGTATGGCCTTTGGAAATGTGTGCTTCCTGAAGAAGATAGTGGTGAGC
TGGCAAAGCCAAAGATTGGTTTTCCAGAGACAACAGAAGAGGAGCTAGAAGAAAT
TGCTTCAGAGAATTCAGATTGCATCTTTCCTTCAGCTCCTGATGTTAAGGCCTGA
GCGTCAATCATATGTGCAGTTAGTATACAACTGACTAAAACAAGCAAGCAGAGAA
AAGCATCAGCCTTCCA
Product name: hSTRAP €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-11102-1
Sigma Product ID: EHU111021
Species: Homo sapiens
Ensembl Gene ID: ENSG00000023734
Ensembl Transcript ID: ENST00000025399, ENST00000419869, ENST00000541731
Gene coordinates (GRCh38): 12:15882391-15903478
HGNC Alias: MAWD, pt-wd, UNRIP
HGNC ID: HGNC:30796
HGNC Symbol: STRAP
NCBI gene: 11171
RefSeq mRNA: NM_007178
Sequence:TGCAACCATCAATTCTGCATCTCTTCATCCTGAGAAAGAATTTCTTGTTGCAGGC
GGTGAAGATTTTAAACTTTATAAGTATGATTATAATAGTGGAGAAGAATTAGAAT
CCTACAAGGGACACTTTGGTCCTATTCACTGTGTGAGATTTAGTCCTGATGGAGA
ACTCTATGCCAGTGGTTCAGAAGATGGAACATTGAGACTATGGCAAACTGTGGTA
GGAAAAACGTATGGCCTTTGGAAATGTGTGCTTCCTGAAGAAGATAGTGGTGAGC
TGGCAAAGCCAAAGATTGGTTTTCCAGAGACAACAGAAGAGGAGCTAGAAGAAAT
TGCTTCAGAGAATTCAGATTGCATCTTTCCTTCAGCTCCTGATGTTAAGGCCTGA
GCGTCAATCATATGTGCAGTTAGTATACAACTGACTAAAACAAGCAAGCAGAGAA
AAGCATCAGCCTTCCA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.