Search our product database

Search options:
Product name: hHNRNPA1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-11127-1
Sigma Product ID: EHU111271
Species: Homo sapiens
Ensembl Gene ID: ENSG00000135486
Ensembl Transcript ID: ENST00000340913
Gene coordinates (GRCh38): 12:54280193-54287088
HGNC Alias: ALS20, hnRNP-A1, hnRNPA1, HNRPA1
HGNC ID: HGNC:5031
HGNC Symbol: HNRNPA1
NCBI gene: 3178
RefSeq mRNA: NM_031157
Sequence:AAAGCCCTGTCAAAGCAAGAGATGGCTAGTGCTTCATCCAGCCAAAGAGGTCGAA
GTGGTTCTGGAAACTTTGGTGGTGGTCGTGGAGGTGGTTTCGGTGGGAATGACAA
CTTCGGTCGTGGAGGAAACTTCAGTGGTCGTGGTGGCTTTGGTGGCAGCCGTGGT
GGTGGTGGATATGGTGGCAGTGGGGATGGCTATAATGGATTTGGTAATGATGGTG
GTTATGGAGGAGGCGGCCCTGGTTACTCTGGAGGAAGCAGAGGCTATGGAAGTGG
TGGACAGGGTTATGGAAACCAGGGCAGTGGCTATGGCGGGAGTGGCAGCTATGAC
AGCTATAACAACGGAGGCGGAGGCGGCTTTGGCGGTGGTAGTGGTAGCAATTTTG
GAGGTGGTGGAAGCTAC
Product name: hHNRNPA1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-11127-1
Sigma Product ID: EHU111271
Species: Homo sapiens
Ensembl Gene ID: ENSG00000135486
Ensembl Transcript ID: ENST00000340913
Gene coordinates (GRCh38): 12:54280193-54287088
HGNC Alias: ALS20, hnRNP-A1, hnRNPA1, HNRPA1
HGNC ID: HGNC:5031
HGNC Symbol: HNRNPA1
NCBI gene: 3178
RefSeq mRNA: NM_031157
Sequence:AAAGCCCTGTCAAAGCAAGAGATGGCTAGTGCTTCATCCAGCCAAAGAGGTCGAA
GTGGTTCTGGAAACTTTGGTGGTGGTCGTGGAGGTGGTTTCGGTGGGAATGACAA
CTTCGGTCGTGGAGGAAACTTCAGTGGTCGTGGTGGCTTTGGTGGCAGCCGTGGT
GGTGGTGGATATGGTGGCAGTGGGGATGGCTATAATGGATTTGGTAATGATGGTG
GTTATGGAGGAGGCGGCCCTGGTTACTCTGGAGGAAGCAGAGGCTATGGAAGTGG
TGGACAGGGTTATGGAAACCAGGGCAGTGGCTATGGCGGGAGTGGCAGCTATGAC
AGCTATAACAACGGAGGCGGAGGCGGCTTTGGCGGTGGTAGTGGTAGCAATTTTG
GAGGTGGTGGAAGCTAC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.