Search our product database

Search options:
Product name: hXRCC6 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-11391-1
Sigma Product ID: EHU113911
Species: Homo sapiens
Ensembl Gene ID: ENSG00000196419
Ensembl Transcript ID: ENST00000359308, ENST00000360079, ENST00000405878
Gene coordinates (GRCh38): 22:41621119-41664048
HGNC Alias: D22S671, D22S731, G22P1, KU70, ML8
HGNC ID: HGNC:4055
HGNC Symbol: XRCC6
NCBI gene: 2547
RefSeq mRNA: NM_001288976, NM_001469
Sequence:AACATGTCAGGGTGGGAGTCATATTACAAAACCGAGGGCGATGAAGAAGCAGAGG
AAGAACAAGAAGAGAACCTTGAAGCAAGTGGAGACTATAAATATTCAGGAAGAGA
TAGTTTGATTTTTTTGGTTGATGCCTCCAAGGCTATGTTTGAATCTCAGAGTGAA
GATGAGTTGACACCTTTTGACATGAGCATCCAGTGTATCCAAAGTGTGTACATCA
GTAAGATCATAAGCAGTGATCGAGATCTCTTGGCTGTGGTGTTCTATGGTACCGA
GAAAGACAAAAATTCAGTGAATTTTAAAAATATTTACGTCTTACAGGAGCTGGAT
AATCCAGGTGCAAAACGAATTCTAGAGCTTGACCAGTTTAAGGGGCAGCAGGGAC
AAAAACGTTTCCAAGACATGATGGGC
Product name: hXRCC6 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-11391-1
Sigma Product ID: EHU113911
Species: Homo sapiens
Ensembl Gene ID: ENSG00000196419
Ensembl Transcript ID: ENST00000359308, ENST00000360079, ENST00000405878
Gene coordinates (GRCh38): 22:41621119-41664048
HGNC Alias: D22S671, D22S731, G22P1, KU70, ML8
HGNC ID: HGNC:4055
HGNC Symbol: XRCC6
NCBI gene: 2547
RefSeq mRNA: NM_001288976, NM_001469
Sequence:AACATGTCAGGGTGGGAGTCATATTACAAAACCGAGGGCGATGAAGAAGCAGAGG
AAGAACAAGAAGAGAACCTTGAAGCAAGTGGAGACTATAAATATTCAGGAAGAGA
TAGTTTGATTTTTTTGGTTGATGCCTCCAAGGCTATGTTTGAATCTCAGAGTGAA
GATGAGTTGACACCTTTTGACATGAGCATCCAGTGTATCCAAAGTGTGTACATCA
GTAAGATCATAAGCAGTGATCGAGATCTCTTGGCTGTGGTGTTCTATGGTACCGA
GAAAGACAAAAATTCAGTGAATTTTAAAAATATTTACGTCTTACAGGAGCTGGAT
AATCCAGGTGCAAAACGAATTCTAGAGCTTGACCAGTTTAAGGGGCAGCAGGGAC
AAAAACGTTTCCAAGACATGATGGGC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.