Search our product database

Search options:
Product name: hPSIP1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-11438-1
Sigma Product ID: EHU114381
Species: Homo sapiens
Ensembl Gene ID: ENSG00000164985
Ensembl Transcript ID: ENST00000380715, ENST00000380716, ENST00000380733, ENST00000380738, ENST00000397519, ENST00000487363
Gene coordinates (GRCh38): 9:15464066-15511019
HGNC Alias: DFS70, LEDGF, p52, p75, PSIP2
HGNC ID: HGNC:9527
HGNC Symbol: PSIP1
NCBI gene: 11168
RefSeq mRNA: NM_001128217, NM_001317898, NM_001317900, NM_021144, NM_033222
Sequence:TCTTCGCCAAGATGAAAGGTTATCCCCATTGGCCAGCTCGAGTAGACGAAGTTCC
TGATGGAGCTGTAAAGCCACCCACAAACAAACTACCCATTTTCTTTTTTGGAACT
CATGAGACTGCTTTTTTAGGACCAAAGGATATATTTCCTTACTCAGAAAATAAGG
AAAAGTATGGCAAACCAAATAAAAGAAAAGGTTTTAATGAAGGTTTATGGGAGAT
AGATAACAATCCAAAAGTGAAATTTTCAAGTCAACAGGCAGCAACTAAACAATCA
AATGCATCATCTGATGTTGAAGTTGAAGAAAAGGAAACTAGTGTTTCAAAGGAAG
ATACCGACCATGAAGAAAAAGCCAGCAATGAGGATGTGACTAAAGCAGTTGACAT
AACTACTCCAAAAGCTGCCAGAAG
Product name: hPSIP1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-11438-1
Sigma Product ID: EHU114381
Species: Homo sapiens
Ensembl Gene ID: ENSG00000164985
Ensembl Transcript ID: ENST00000380715, ENST00000380716, ENST00000380733, ENST00000380738, ENST00000397519, ENST00000487363
Gene coordinates (GRCh38): 9:15464066-15511019
HGNC Alias: DFS70, LEDGF, p52, p75, PSIP2
HGNC ID: HGNC:9527
HGNC Symbol: PSIP1
NCBI gene: 11168
RefSeq mRNA: NM_001128217, NM_001317898, NM_001317900, NM_021144, NM_033222
Sequence:TCTTCGCCAAGATGAAAGGTTATCCCCATTGGCCAGCTCGAGTAGACGAAGTTCC
TGATGGAGCTGTAAAGCCACCCACAAACAAACTACCCATTTTCTTTTTTGGAACT
CATGAGACTGCTTTTTTAGGACCAAAGGATATATTTCCTTACTCAGAAAATAAGG
AAAAGTATGGCAAACCAAATAAAAGAAAAGGTTTTAATGAAGGTTTATGGGAGAT
AGATAACAATCCAAAAGTGAAATTTTCAAGTCAACAGGCAGCAACTAAACAATCA
AATGCATCATCTGATGTTGAAGTTGAAGAAAAGGAAACTAGTGTTTCAAAGGAAG
ATACCGACCATGAAGAAAAAGCCAGCAATGAGGATGTGACTAAAGCAGTTGACAT
AACTACTCCAAAAGCTGCCAGAAG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.