Search our product database

Search options:
Product name: hTERF1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-11482-1
Sigma Product ID: EHU114821
Species: Homo sapiens
Ensembl Gene ID: ENSG00000147601
Ensembl Transcript ID: ENST00000276602, ENST00000276603, ENST00000517390
Gene coordinates (GRCh38): 8:73008864-73048122
HGNC Alias: PIN2, TRBF1, TRF, TRF1
HGNC ID: HGNC:11728
HGNC Symbol: TERF1
NCBI gene: 7013
RefSeq mRNA: NM_003218, NM_017489
Sequence:CCCTTGATGCACAGTTTGAAAATGATGAACGAATTACACCCTTGGAATCAGCCCT
GATGATTTGGGGTTCAATTGAAAAGGAACATGACAAACTTCATGAAGAAATACAG
AATTTAATTAAAATTCAGGCTATAGCTGTTTGTATGGAAAATGGCAACTTTAAAG
AAGCAGAAGAAGTCTTTGAAAGAATATTTGGTGATCCAAATTCTCATATGCCTTT
CAAAAGCAAATTGCTTATGATAATCTCTCAGAAAGATACATTTCATTCCTTTTTT
CAACACTTCAGCTACAACCACATGATGGAGAAAATTAAGAGTTATGTGAATTATG
TGCTAAGTGAAAAATCATCAACCTTTCTAATGAAGGCAGCGGCAAAAGTAGTAGA
AAGCAAAAGGACAAGAACAA
Product name: hTERF1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-11482-1
Sigma Product ID: EHU114821
Species: Homo sapiens
Ensembl Gene ID: ENSG00000147601
Ensembl Transcript ID: ENST00000276602, ENST00000276603, ENST00000517390
Gene coordinates (GRCh38): 8:73008864-73048122
HGNC Alias: PIN2, TRBF1, TRF, TRF1
HGNC ID: HGNC:11728
HGNC Symbol: TERF1
NCBI gene: 7013
RefSeq mRNA: NM_003218, NM_017489
Sequence:CCCTTGATGCACAGTTTGAAAATGATGAACGAATTACACCCTTGGAATCAGCCCT
GATGATTTGGGGTTCAATTGAAAAGGAACATGACAAACTTCATGAAGAAATACAG
AATTTAATTAAAATTCAGGCTATAGCTGTTTGTATGGAAAATGGCAACTTTAAAG
AAGCAGAAGAAGTCTTTGAAAGAATATTTGGTGATCCAAATTCTCATATGCCTTT
CAAAAGCAAATTGCTTATGATAATCTCTCAGAAAGATACATTTCATTCCTTTTTT
CAACACTTCAGCTACAACCACATGATGGAGAAAATTAAGAGTTATGTGAATTATG
TGCTAAGTGAAAAATCATCAACCTTTCTAATGAAGGCAGCGGCAAAAGTAGTAGA
AAGCAAAAGGACAAGAACAA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.