Search our product database

Search options:
Product name: hCDC42 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-11724-1
Sigma Product ID: EHU117241
Species: Homo sapiens
Ensembl Gene ID: ENSG00000070831, ENSG00000285721
Ensembl Transcript ID: ENST00000315554, ENST00000344548, ENST00000400259, ENST00000498236, ENST00000648594
Gene coordinates (GRCh38): 1:22025511-22101360, 1:22052627-22092946
HGNC Alias: CDC42Hs, G25K
HGNC ID: HGNC:1736
HGNC Symbol: CDC42
NCBI gene: 998
RefSeq mRNA: NM_001039802, NM_001791, NM_044472
Sequence:ACTGCAGGGCAAGAGGATTATGACAGATTACGACCGCTGAGTTATCCACAAACAG
ATGTATTTCTAGTCTGTTTTTCAGTGGTCTCTCCATCTTCATTTGAAAACGTGAA
AGAAAAGTGGGTGCCTGAGATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTT
GTTGGGACTCAAATTGATCTCAGAGATGACCCCTCTACTATTGAGAAACTTGCCA
AGAACAAACAGAAGCCTATCACTCCAGAGACTGCTGAAAAGCTGGCCCGTGACCT
GAAGGCTGTCAAGTATGTGGAGTGTTCTGCACTTACACA
Product name: hCDC42 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-11724-1
Sigma Product ID: EHU117241
Species: Homo sapiens
Ensembl Gene ID: ENSG00000070831, ENSG00000285721
Ensembl Transcript ID: ENST00000315554, ENST00000344548, ENST00000400259, ENST00000498236, ENST00000648594
Gene coordinates (GRCh38): 1:22025511-22101360, 1:22052627-22092946
HGNC Alias: CDC42Hs, G25K
HGNC ID: HGNC:1736
HGNC Symbol: CDC42
NCBI gene: 998
RefSeq mRNA: NM_001039802, NM_001791, NM_044472
Sequence:ACTGCAGGGCAAGAGGATTATGACAGATTACGACCGCTGAGTTATCCACAAACAG
ATGTATTTCTAGTCTGTTTTTCAGTGGTCTCTCCATCTTCATTTGAAAACGTGAA
AGAAAAGTGGGTGCCTGAGATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTT
GTTGGGACTCAAATTGATCTCAGAGATGACCCCTCTACTATTGAGAAACTTGCCA
AGAACAAACAGAAGCCTATCACTCCAGAGACTGCTGAAAAGCTGGCCCGTGACCT
GAAGGCTGTCAAGTATGTGGAGTGTTCTGCACTTACACA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.