Search our product database

Search options:
Product name: hARL6IP6 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-11968-1
Sigma Product ID: EHU119681
Species: Homo sapiens
Ensembl Gene ID: ENSG00000177917
Ensembl Transcript ID: ENST00000326446
Gene coordinates (GRCh38): 2:152717893-152761253
HGNC Alias: MGC33864
HGNC ID: HGNC:24048
HGNC Symbol: ARL6IP6
NCBI gene: 151188
RefSeq mRNA: NM_001350068, NM_152522
RefSeq ncRNA: NR_146424, NR_146426, NR_146429, NR_146431
Sequence:GTTTACCCCTGGGCTCTGAGGCCTGGTGGTAGCGGCCACTGCCGCGGATTGGCTG
TTGCGGACCCGGGGCGGGGCAGGTGGGAGAGGCTCGTTCTCCGCGGGTTTCGTTG
TGTTTCGCGCCATGTCGTTTGCTGAGAGCGGGTGGCGGTCGGCTCTGCGGCGCCG
CGGTCCCGGCACCCCGGGCCCTGTGGCTCGGCCATCGTATTCCTCCTTTACTCAG
GGGGACAGCTGGGGTGAAGGCGAAGTCGACGAGGAGGAGGGATGCGACCAAGTGG
CCCGCGACCTGCGGGCGGAGTTCTCGGCTGGGGCGTGGTCAGAGCCCAGAAAGCG
CTCGGTGCTCCCGCCGGACGGGAACGGGTCGCCCGTTCTGCCCGATAAGCGCAAT
GGTATCTTTCCCGCGGCCGCGGGCAGCAGAGCCCAGCCTCGGCGGTGGCCGGTCC
AGGTCCTCTCTATTCTCTGCTCGCTGCTCTTCGCCATTCTTCTCGCCTTCCTCCT
CGCCATCGCCTACTTGATCGTT
Product name: hARL6IP6 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-11968-1
Sigma Product ID: EHU119681
Species: Homo sapiens
Ensembl Gene ID: ENSG00000177917
Ensembl Transcript ID: ENST00000326446
Gene coordinates (GRCh38): 2:152717893-152761253
HGNC Alias: MGC33864
HGNC ID: HGNC:24048
HGNC Symbol: ARL6IP6
NCBI gene: 151188
RefSeq mRNA: NM_001350068, NM_152522
RefSeq ncRNA: NR_146424, NR_146426, NR_146429, NR_146431
Sequence:GTTTACCCCTGGGCTCTGAGGCCTGGTGGTAGCGGCCACTGCCGCGGATTGGCTG
TTGCGGACCCGGGGCGGGGCAGGTGGGAGAGGCTCGTTCTCCGCGGGTTTCGTTG
TGTTTCGCGCCATGTCGTTTGCTGAGAGCGGGTGGCGGTCGGCTCTGCGGCGCCG
CGGTCCCGGCACCCCGGGCCCTGTGGCTCGGCCATCGTATTCCTCCTTTACTCAG
GGGGACAGCTGGGGTGAAGGCGAAGTCGACGAGGAGGAGGGATGCGACCAAGTGG
CCCGCGACCTGCGGGCGGAGTTCTCGGCTGGGGCGTGGTCAGAGCCCAGAAAGCG
CTCGGTGCTCCCGCCGGACGGGAACGGGTCGCCCGTTCTGCCCGATAAGCGCAAT
GGTATCTTTCCCGCGGCCGCGGGCAGCAGAGCCCAGCCTCGGCGGTGGCCGGTCC
AGGTCCTCTCTATTCTCTGCTCGCTGCTCTTCGCCATTCTTCTCGCCTTCCTCCT
CGCCATCGCCTACTTGATCGTT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.