Search our product database

Search options:
Product name: hUBL5 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-12220-1
Sigma Product ID: EHU122201
Species: Homo sapiens
Ensembl Gene ID: ENSG00000198258
Ensembl Transcript ID: ENST00000358666
Gene coordinates (GRCh38): 19:9827892-9830115
HGNC ID: HGNC:13736
HGNC Symbol: UBL5
NCBI gene: 59286
RefSeq mRNA: NM_024292
Sequence:AACTTCCGCTTCCGGTTCCTAGCGTTAACTGCGACCGGGGTTCAGCGCTCGGGTG
AGGAGCTGGTGGCGTCGGCAGGTTCGAGGCGATTCGAGGTGAGGGGGTCAAGCGG
AGAGGCTCGGAGTCGGAGAAAGCTGTCGCGACCCAGCCACCCAGGGTCTGGGGTC
GGTGGGAGCTCCAGCTAGGATGATCGAGGTTGTTTGCAACGACCGTCTGGGGAAG
AAGGTCCGCGTTAAATGCAACACGGATGATACCATCGGGGACCTTAAGAAGCTGA
TTGCAGCCCAAACTGGTACCCGTTGGAACAAGATTGTCCTGAAGAAGTGGTACAC
GATTTTTAAGGACCACGTGTCTCTGGGGGACTATGAAATCCACGATGGGATGAAC
Product name: hUBL5 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-12220-1
Sigma Product ID: EHU122201
Species: Homo sapiens
Ensembl Gene ID: ENSG00000198258
Ensembl Transcript ID: ENST00000358666
Gene coordinates (GRCh38): 19:9827892-9830115
HGNC ID: HGNC:13736
HGNC Symbol: UBL5
NCBI gene: 59286
RefSeq mRNA: NM_024292
Sequence:AACTTCCGCTTCCGGTTCCTAGCGTTAACTGCGACCGGGGTTCAGCGCTCGGGTG
AGGAGCTGGTGGCGTCGGCAGGTTCGAGGCGATTCGAGGTGAGGGGGTCAAGCGG
AGAGGCTCGGAGTCGGAGAAAGCTGTCGCGACCCAGCCACCCAGGGTCTGGGGTC
GGTGGGAGCTCCAGCTAGGATGATCGAGGTTGTTTGCAACGACCGTCTGGGGAAG
AAGGTCCGCGTTAAATGCAACACGGATGATACCATCGGGGACCTTAAGAAGCTGA
TTGCAGCCCAAACTGGTACCCGTTGGAACAAGATTGTCCTGAAGAAGTGGTACAC
GATTTTTAAGGACCACGTGTCTCTGGGGGACTATGAAATCCACGATGGGATGAAC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.