Search our product database

Search options:
Product name: hHMGA1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-12272-1
Sigma Product ID: EHU122721
Species: Homo sapiens
Ensembl Gene ID: ENSG00000137309
Ensembl Transcript ID: ENST00000311487, ENST00000347617, ENST00000374116, ENST00000401473, ENST00000447654
Gene coordinates (GRCh38): 6:34236873-34246231
HGNC Alias: HMGIY
HGNC ID: HGNC:5010
HGNC Symbol: HMGA1
NCBI gene: 3159
RefSeq mRNA: NM_001319077, NM_001319078, NM_001319079, NM_001319080, NM_001319081, NM_001319082, NM_002131, NM_145899, NM_145901, NM_145902, NM_145903, NM_145905
Sequence:CCCAGCCAAACTGTCTTTGTCACCACGTGGGGCTCACTTTTCATCCTTCCCCAAC
TTCCCTAGTCCCCGTACTAGGTTGGACAGCCCCCTTCGGTTACAGGAAGGCAGGA
GGGGTGAGTCCCCTACTCCCTCTTCACTGTGGCCACAGCCCCCTTGCCCTCCGCC
TGGGATCTGAGTACATATTGTGGTGATGGAGATGCAGTCACTTATTGTCCAGGTG
AGGCCCAAGAGCCCTGTGGCCGCCACCTGAGGTGGGCTGGGGCTGCTCCCCTAAC
CCTACTTTGCTTCCGCCACTCAGCCATTTCCCCCTCCTCAGATGGGGCACCAATA
ACAAGGAGCTCACCCTGCCCGCTCCCAACCCCCCTCCTGCTCCTCCCTGCCCCCC
AAGGTTCTGGTTCCATTTTTCCTCTGTTCACAAACTACCTCTGGACAGTTGTGTT
GTTTTTTGTTCAATGTTCCATTCTTCGACATCCGTCATTG
Product name: hHMGA1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-12272-1
Sigma Product ID: EHU122721
Species: Homo sapiens
Ensembl Gene ID: ENSG00000137309
Ensembl Transcript ID: ENST00000311487, ENST00000347617, ENST00000374116, ENST00000401473, ENST00000447654
Gene coordinates (GRCh38): 6:34236873-34246231
HGNC Alias: HMGIY
HGNC ID: HGNC:5010
HGNC Symbol: HMGA1
NCBI gene: 3159
RefSeq mRNA: NM_001319077, NM_001319078, NM_001319079, NM_001319080, NM_001319081, NM_001319082, NM_002131, NM_145899, NM_145901, NM_145902, NM_145903, NM_145905
Sequence:CCCAGCCAAACTGTCTTTGTCACCACGTGGGGCTCACTTTTCATCCTTCCCCAAC
TTCCCTAGTCCCCGTACTAGGTTGGACAGCCCCCTTCGGTTACAGGAAGGCAGGA
GGGGTGAGTCCCCTACTCCCTCTTCACTGTGGCCACAGCCCCCTTGCCCTCCGCC
TGGGATCTGAGTACATATTGTGGTGATGGAGATGCAGTCACTTATTGTCCAGGTG
AGGCCCAAGAGCCCTGTGGCCGCCACCTGAGGTGGGCTGGGGCTGCTCCCCTAAC
CCTACTTTGCTTCCGCCACTCAGCCATTTCCCCCTCCTCAGATGGGGCACCAATA
ACAAGGAGCTCACCCTGCCCGCTCCCAACCCCCCTCCTGCTCCTCCCTGCCCCCC
AAGGTTCTGGTTCCATTTTTCCTCTGTTCACAAACTACCTCTGGACAGTTGTGTT
GTTTTTTGTTCAATGTTCCATTCTTCGACATCCGTCATTG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.