Search our product database

Search options:
Product name: hH3F3A €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-12709-1
Sigma Product ID: EHU127091
Species: Homo sapiens
Ensembl Gene ID: ENSG00000163041
Ensembl Transcript ID: ENST00000366813, ENST00000366815
Gene coordinates (GRCh38): 1:226061851-226072001
HGNC Alias: H3.3A, H3F3
HGNC ID: HGNC:4764
HGNC Symbol: H3F3A
NCBI gene: 3020
RefSeq mRNA: NM_002107
Sequence:TGATTCGCAAACTTCCCTTCCAGCGTCTGGTGCGAGAAATTGCTCAGGACTTTAA
AACAGATCTGCGCTTCCAGAGCGCAGCTATCGGTGCTTTGCAGGAGGCAAGTGAG
GCCTATCTGGTTGGCCTTTTTGAAGACACCAACCTGTGTGCTATCCATGCCAAAC
GTGTAACAATTATGCCAAAAGACATCCAGCTAGCACGCCGCATACGTGGAGAACG
TGCTTAAGAATCCACTATGATGGGAAACATTTCATTCTCAAAAAAAAAAAAAAAA
ATTTCTCTTCTTCCTGTTATTGGTAGTTCTGAACGTTAGATATTTTTTTTCCATG
GGGTCAAAAGGTACCTAAGTATATGATTGCGAGTGGAAAAATAGGGGACAGAAAT
CAGGTATTGGCAGTTTTTCCATTTTCATTTGTGTGTGAATTTTTAATATAAATGC
GGAGACGTAAAGCAT
Product name: hH3F3A €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-12709-1
Sigma Product ID: EHU127091
Species: Homo sapiens
Ensembl Gene ID: ENSG00000163041
Ensembl Transcript ID: ENST00000366813, ENST00000366815
Gene coordinates (GRCh38): 1:226061851-226072001
HGNC Alias: H3.3A, H3F3
HGNC ID: HGNC:4764
HGNC Symbol: H3F3A
NCBI gene: 3020
RefSeq mRNA: NM_002107
Sequence:TGATTCGCAAACTTCCCTTCCAGCGTCTGGTGCGAGAAATTGCTCAGGACTTTAA
AACAGATCTGCGCTTCCAGAGCGCAGCTATCGGTGCTTTGCAGGAGGCAAGTGAG
GCCTATCTGGTTGGCCTTTTTGAAGACACCAACCTGTGTGCTATCCATGCCAAAC
GTGTAACAATTATGCCAAAAGACATCCAGCTAGCACGCCGCATACGTGGAGAACG
TGCTTAAGAATCCACTATGATGGGAAACATTTCATTCTCAAAAAAAAAAAAAAAA
ATTTCTCTTCTTCCTGTTATTGGTAGTTCTGAACGTTAGATATTTTTTTTCCATG
GGGTCAAAAGGTACCTAAGTATATGATTGCGAGTGGAAAAATAGGGGACAGAAAT
CAGGTATTGGCAGTTTTTCCATTTTCATTTGTGTGTGAATTTTTAATATAAATGC
GGAGACGTAAAGCAT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.