Search our product database

Search options:
Product name: hXK €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-13077-1
Sigma Product ID: EHU130771
Species: Homo sapiens
Ensembl Gene ID: ENSG00000047597
Ensembl Transcript ID: ENST00000378616
Gene coordinates (GRCh38): X:37685756-37732130
HGNC Alias: Kx, NA, NAC, X1k, XKR1
HGNC ID: HGNC:12811
HGNC Symbol: XK
NCBI gene: 7504
RefSeq mRNA: NM_021083
Sequence:CTTCCTGTGGAGGAGCTTTGAGATTGCCACTCGAGTTGTAGTCCTGGTCCTCTTT
ACCTCCGTCCTGAAGACCTGGGTGGTGGTTATAATACTCATCAACTTCTTCAGTT
TCTTCTTGTACCCCTGGATCCTCTTCTGGTGCAGTGGTTCCCCATTCCCTGAGAA
CATAGAGAAGGCCCTCAGTAGAGTGGGCACCACCATTGTACTATGCTTTCTAACT
TTACTCTATACTGGTATCAACATGTTCTGCTGGTCTGCTGTACAGCTGAAAATTG
ACAGCCCTGACCTCATCAGCAAGTCCCATAATTGGTACCAGCTACTGGTGTATTA
CATGATAAGATTCATCGAGAATGCCATCCTCCTCCTCCTGTGGTATCTTTTCAAG
ACTGACATCTATATGTATGTGTGCGCACCTCT
Product name: hXK €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-13077-1
Sigma Product ID: EHU130771
Species: Homo sapiens
Ensembl Gene ID: ENSG00000047597
Ensembl Transcript ID: ENST00000378616
Gene coordinates (GRCh38): X:37685756-37732130
HGNC Alias: Kx, NA, NAC, X1k, XKR1
HGNC ID: HGNC:12811
HGNC Symbol: XK
NCBI gene: 7504
RefSeq mRNA: NM_021083
Sequence:CTTCCTGTGGAGGAGCTTTGAGATTGCCACTCGAGTTGTAGTCCTGGTCCTCTTT
ACCTCCGTCCTGAAGACCTGGGTGGTGGTTATAATACTCATCAACTTCTTCAGTT
TCTTCTTGTACCCCTGGATCCTCTTCTGGTGCAGTGGTTCCCCATTCCCTGAGAA
CATAGAGAAGGCCCTCAGTAGAGTGGGCACCACCATTGTACTATGCTTTCTAACT
TTACTCTATACTGGTATCAACATGTTCTGCTGGTCTGCTGTACAGCTGAAAATTG
ACAGCCCTGACCTCATCAGCAAGTCCCATAATTGGTACCAGCTACTGGTGTATTA
CATGATAAGATTCATCGAGAATGCCATCCTCCTCCTCCTGTGGTATCTTTTCAAG
ACTGACATCTATATGTATGTGTGCGCACCTCT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.