Search our product database

Search options:
Product name: hSKP1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-13425-1
Sigma Product ID: EHU134251
Species: Homo sapiens
Ensembl Gene ID: ENSG00000113558
Ensembl Transcript ID: ENST00000328392, ENST00000353411, ENST00000517625, ENST00000519054, ENST00000519321, ENST00000522552, ENST00000522855, ENST00000523966
Gene coordinates (GRCh38): 5:134148935-134177038
HGNC Alias: EMC19, MGC34403, OCP2, OCP-II, p19A, SKP1A, TCEB1L
HGNC ID: HGNC:10899
HGNC Symbol: SKP1
NCBI gene: 6500
RefSeq mRNA: NM_006930, NM_170679
Sequence:CCGTCTCCTTAACACCGAACACCATGCCTTCAATTAAGTTGCAGAGTTCTGATGG
AGAGATATTTGAAGTTGATGTGGAAATTGCCAAACAATCTGTGACTATTAAGACC
ATGTTGGAAGATTTGGGAATGGATGATGAAGGAGATGATGACCCAGTTCCTCTAC
CAAATGTGAATGCAGCAATATTAAAAAAGGTCATTCAGTGGTGCACCCACCACAA
GGATGACCCTCCTCCTCCTGAAGATGATGAGAACAAAGAAAAGCGAACAGATGAT
ATCCCTGTTTGGGACCAAGAATTCCTGAAAGTTGACCAAGGAACACTTTTTGAAC
TCATTCTGGCTGCAAACTACTTAGACATCAAAGGTTTGCTTGATGTTACATGCAA
GACTGTTGCCAATATGATCAAGGGGAAAACTCCTGAGGAGATTCGCAAGACCT
Product name: hSKP1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-13425-1
Sigma Product ID: EHU134251
Species: Homo sapiens
Ensembl Gene ID: ENSG00000113558
Ensembl Transcript ID: ENST00000328392, ENST00000353411, ENST00000517625, ENST00000519054, ENST00000519321, ENST00000522552, ENST00000522855, ENST00000523966
Gene coordinates (GRCh38): 5:134148935-134177038
HGNC Alias: EMC19, MGC34403, OCP2, OCP-II, p19A, SKP1A, TCEB1L
HGNC ID: HGNC:10899
HGNC Symbol: SKP1
NCBI gene: 6500
RefSeq mRNA: NM_006930, NM_170679
Sequence:CCGTCTCCTTAACACCGAACACCATGCCTTCAATTAAGTTGCAGAGTTCTGATGG
AGAGATATTTGAAGTTGATGTGGAAATTGCCAAACAATCTGTGACTATTAAGACC
ATGTTGGAAGATTTGGGAATGGATGATGAAGGAGATGATGACCCAGTTCCTCTAC
CAAATGTGAATGCAGCAATATTAAAAAAGGTCATTCAGTGGTGCACCCACCACAA
GGATGACCCTCCTCCTCCTGAAGATGATGAGAACAAAGAAAAGCGAACAGATGAT
ATCCCTGTTTGGGACCAAGAATTCCTGAAAGTTGACCAAGGAACACTTTTTGAAC
TCATTCTGGCTGCAAACTACTTAGACATCAAAGGTTTGCTTGATGTTACATGCAA
GACTGTTGCCAATATGATCAAGGGGAAAACTCCTGAGGAGATTCGCAAGACCT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.