Search our product database

Search options:
Product name: hINIP €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-13508-1
Sigma Product ID: EHU135081
Species: Homo sapiens
Ensembl Gene ID: ENSG00000148153
Ensembl Transcript ID: ENST00000374236, ENST00000374242, ENST00000497712
Gene coordinates (GRCh38): 9:112683926-112718236
HGNC Alias: C9orf80, HSPC043, hSSBIP1, MISE, SOSS-C
HGNC ID: HGNC:24994
HGNC Symbol: INIP
NCBI gene: 58493
RefSeq mRNA: NM_001329585, NM_001329586, NM_001329587, NM_001329588, NM_001329589, NM_001329590, NM_021218
Sequence:TCATCCTGGAGCTAGCATTGCACTCTCGAGACCCTCTCTTAATAAGGACTTCCGG
GATCACGCTGAGCAGCAGCATATTGCAGCCCAACAGAAGGCAGCTTTGCAGCATG
CTCATGCACATTCATCTGGATACTTCATCACTCAAGACTCTGCATTTGGGAACCT
TATTCTTCCTGTTTTACCTCGCCTTGACCCAGAATGAAGAAAACATTTGCGATGG
AAAAGTGACTTTGTAATATCAAATGCCAAAGCTACTATCATTCAGTGCTACATGA
ACTGTGACTTTAAGAATTTTGGTGAACTTTGATATTTTTTGTTTGTCTGAAAGAA
AGGAATGTGTAAGTGAAAGCTGAAAGAAGAATAACCAGGATGATGAGAGCTGTGG
AAGCTGTATCGTCCA
Product name: hINIP €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-13508-1
Sigma Product ID: EHU135081
Species: Homo sapiens
Ensembl Gene ID: ENSG00000148153
Ensembl Transcript ID: ENST00000374236, ENST00000374242, ENST00000497712
Gene coordinates (GRCh38): 9:112683926-112718236
HGNC Alias: C9orf80, HSPC043, hSSBIP1, MISE, SOSS-C
HGNC ID: HGNC:24994
HGNC Symbol: INIP
NCBI gene: 58493
RefSeq mRNA: NM_001329585, NM_001329586, NM_001329587, NM_001329588, NM_001329589, NM_001329590, NM_021218
Sequence:TCATCCTGGAGCTAGCATTGCACTCTCGAGACCCTCTCTTAATAAGGACTTCCGG
GATCACGCTGAGCAGCAGCATATTGCAGCCCAACAGAAGGCAGCTTTGCAGCATG
CTCATGCACATTCATCTGGATACTTCATCACTCAAGACTCTGCATTTGGGAACCT
TATTCTTCCTGTTTTACCTCGCCTTGACCCAGAATGAAGAAAACATTTGCGATGG
AAAAGTGACTTTGTAATATCAAATGCCAAAGCTACTATCATTCAGTGCTACATGA
ACTGTGACTTTAAGAATTTTGGTGAACTTTGATATTTTTTGTTTGTCTGAAAGAA
AGGAATGTGTAAGTGAAAGCTGAAAGAAGAATAACCAGGATGATGAGAGCTGTGG
AAGCTGTATCGTCCA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.