Search our product database

Search options:
Product name: hGSTCD €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-13524-1
Sigma Product ID: EHU135241
Species: Homo sapiens
Ensembl Gene ID: ENSG00000138780
Ensembl Transcript ID: ENST00000360505, ENST00000394728, ENST00000394730, ENST00000484843, ENST00000507281, ENST00000515279
Gene coordinates (GRCh38): 4:105708778-105847728
HGNC Alias: FLJ13273
HGNC ID: HGNC:25806
HGNC Symbol: GSTCD
NCBI gene: 79807
RefSeq mRNA: NM_001031720, NM_024751
Sequence:TAAGGGAAAGGCAAAGAGCAAGGTCCACACACAGGAAACATCTGAAGGGTTGGAT
TCTTCATCCAAGAGTCTGGAACTGAAAGTGGCATTCTCAAAGCTCACAGTACAGG
AAGAACCAGCTACTACCAACAGAGAGCCTTCTCACATCAGAAAAGCAAAAGCCTC
CGACCTTCCACCTCTGGAGCATGTGTTTGCAGAAGGGCTTTACTTCACTCTGGCA
GATATTGTGCTCTTGCCCTGTATCCATCATTTCTTGGTAATTATCAGCAGGAAAT
TTTCTGAGAAGCTGGTAGAATTTCCATTGCTAGCCTCTTGGTACCAGAGGATTCA
GGAAGTGCCAGGAGTAAAAACAGCAGCTTCTAAGTGTGGGATCCAATTTCTCCAT
TTACCAAAGTTGTTGACAACCTCAACTGAACAGCATCCA
Product name: hGSTCD €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-13524-1
Sigma Product ID: EHU135241
Species: Homo sapiens
Ensembl Gene ID: ENSG00000138780
Ensembl Transcript ID: ENST00000360505, ENST00000394728, ENST00000394730, ENST00000484843, ENST00000507281, ENST00000515279
Gene coordinates (GRCh38): 4:105708778-105847728
HGNC Alias: FLJ13273
HGNC ID: HGNC:25806
HGNC Symbol: GSTCD
NCBI gene: 79807
RefSeq mRNA: NM_001031720, NM_024751
Sequence:TAAGGGAAAGGCAAAGAGCAAGGTCCACACACAGGAAACATCTGAAGGGTTGGAT
TCTTCATCCAAGAGTCTGGAACTGAAAGTGGCATTCTCAAAGCTCACAGTACAGG
AAGAACCAGCTACTACCAACAGAGAGCCTTCTCACATCAGAAAAGCAAAAGCCTC
CGACCTTCCACCTCTGGAGCATGTGTTTGCAGAAGGGCTTTACTTCACTCTGGCA
GATATTGTGCTCTTGCCCTGTATCCATCATTTCTTGGTAATTATCAGCAGGAAAT
TTTCTGAGAAGCTGGTAGAATTTCCATTGCTAGCCTCTTGGTACCAGAGGATTCA
GGAAGTGCCAGGAGTAAAAACAGCAGCTTCTAAGTGTGGGATCCAATTTCTCCAT
TTACCAAAGTTGTTGACAACCTCAACTGAACAGCATCCA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.