Search our product database

Search options:
Product name: hMAP2K7 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-13618-1
Sigma Product ID: EHU136181
Species: Homo sapiens
Ensembl Gene ID: ENSG00000076984
Ensembl Transcript ID: ENST00000397979, ENST00000397981, ENST00000397983, ENST00000468058
Gene coordinates (GRCh38): 19:7903843-7914478
HGNC Alias: Jnkk2, MKK7, PRKMK7
HGNC ID: HGNC:6847
HGNC Symbol: MAP2K7
NCBI gene: 5609
RefSeq mRNA: NM_001297555, NM_001297556, NM_145185
Sequence:AGTGCTTTGGGACGTTCATCACCAACACGGACGTCTTCATCGCCATGGAGCTCAT
GGGCACCTGCGCTGAGAAGCTCAAGAAGCGGATGCAGGGCCCCATCCCCGAGCGC
ATTCTGGGCAAGATGACAGTGGCGATTGTGAAGGCGCTGTACTACCTGAAGGAGA
AGCACGGTGTCATCCACCGCGACGTCAAGCCCTCCAACATCCTGCTGGACGAGCG
GGGCCAGATCAAGCTCTGCGACTTCGGCATCAGCGGCCGCCTGGTGGACTCCAAA
GCCAAGACGCGGAGCGCCGGCTGTGCCGCCTACATGGCACCCGAGCGCATTGACC
CCCCAGACCCCACCAAGCCGGACTATGACATCCGGGCCGACGTATGGAGCCTGGG
CATCTCGTTGGTGGAGCTGGCAACAGGACAGTTTCCCTACAAGAACTGCAAGACG
GACTTTGAGGTCCTCACCAAAGTCCTACAGGAAGAGCCCCCGCTTCTGCCCGGAC
ACATGGGCTTCTCGGGGGACTTCCAGTCCTTCGTCAAAGACTGCCT
Product name: hMAP2K7 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-13618-1
Sigma Product ID: EHU136181
Species: Homo sapiens
Ensembl Gene ID: ENSG00000076984
Ensembl Transcript ID: ENST00000397979, ENST00000397981, ENST00000397983, ENST00000468058
Gene coordinates (GRCh38): 19:7903843-7914478
HGNC Alias: Jnkk2, MKK7, PRKMK7
HGNC ID: HGNC:6847
HGNC Symbol: MAP2K7
NCBI gene: 5609
RefSeq mRNA: NM_001297555, NM_001297556, NM_145185
Sequence:AGTGCTTTGGGACGTTCATCACCAACACGGACGTCTTCATCGCCATGGAGCTCAT
GGGCACCTGCGCTGAGAAGCTCAAGAAGCGGATGCAGGGCCCCATCCCCGAGCGC
ATTCTGGGCAAGATGACAGTGGCGATTGTGAAGGCGCTGTACTACCTGAAGGAGA
AGCACGGTGTCATCCACCGCGACGTCAAGCCCTCCAACATCCTGCTGGACGAGCG
GGGCCAGATCAAGCTCTGCGACTTCGGCATCAGCGGCCGCCTGGTGGACTCCAAA
GCCAAGACGCGGAGCGCCGGCTGTGCCGCCTACATGGCACCCGAGCGCATTGACC
CCCCAGACCCCACCAAGCCGGACTATGACATCCGGGCCGACGTATGGAGCCTGGG
CATCTCGTTGGTGGAGCTGGCAACAGGACAGTTTCCCTACAAGAACTGCAAGACG
GACTTTGAGGTCCTCACCAAAGTCCTACAGGAAGAGCCCCCGCTTCTGCCCGGAC
ACATGGGCTTCTCGGGGGACTTCCAGTCCTTCGTCAAAGACTGCCT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.