Search our product database

Search options:
Product name: hCETN2 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-13703-1
Sigma Product ID: EHU137031
Species: Homo sapiens
Ensembl Gene ID: ENSG00000147400
Ensembl Transcript ID: ENST00000370277
Gene coordinates (GRCh38): X:152826973-152830777
HGNC Alias: CALT, CEN2
HGNC ID: HGNC:1867
HGNC Symbol: CETN2
NCBI gene: 1069
RefSeq mRNA: NM_004344
Sequence:GGAGTTGGGTGAGAACCTGACTGATGAGGAGCTGCAGGAAATGATTGATGAAGCT
GATCGAGATGGAGATGGAGAGGTCAGTGAGCAAGAGTTCCTGCGCATCATGAAAA
AGACCAGCCTCTATTAAGATCAGTGTCTTCTTTTTCTACTGCAAGCACATGTAAC
TAGATTTAGTGCCTGCCATGGTGTGAAATCTGGCTTTTGAGAACACAAACTTTTC
CCCCACGGACCTCCCTTTATCACTTTAATAGTGACCTTGAGCCTATTTTAGCCGT
TTGGAAGTGTTCTTTGATATTACAGTTCTTTGTAAAATGACCTGCGAATTACCCT
AATTCTCAAAAGCAAAACAAGAGCACACAAGCGTGAAGAAAAGGATCTTAAAGCT
TTGAGCACCTGCCATTTTGCCTTGCATCGTTTCCCTCGTCATGCATTT
Product name: hCETN2 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-13703-1
Sigma Product ID: EHU137031
Species: Homo sapiens
Ensembl Gene ID: ENSG00000147400
Ensembl Transcript ID: ENST00000370277
Gene coordinates (GRCh38): X:152826973-152830777
HGNC Alias: CALT, CEN2
HGNC ID: HGNC:1867
HGNC Symbol: CETN2
NCBI gene: 1069
RefSeq mRNA: NM_004344
Sequence:GGAGTTGGGTGAGAACCTGACTGATGAGGAGCTGCAGGAAATGATTGATGAAGCT
GATCGAGATGGAGATGGAGAGGTCAGTGAGCAAGAGTTCCTGCGCATCATGAAAA
AGACCAGCCTCTATTAAGATCAGTGTCTTCTTTTTCTACTGCAAGCACATGTAAC
TAGATTTAGTGCCTGCCATGGTGTGAAATCTGGCTTTTGAGAACACAAACTTTTC
CCCCACGGACCTCCCTTTATCACTTTAATAGTGACCTTGAGCCTATTTTAGCCGT
TTGGAAGTGTTCTTTGATATTACAGTTCTTTGTAAAATGACCTGCGAATTACCCT
AATTCTCAAAAGCAAAACAAGAGCACACAAGCGTGAAGAAAAGGATCTTAAAGCT
TTGAGCACCTGCCATTTTGCCTTGCATCGTTTCCCTCGTCATGCATTT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.