Search our product database

Search options:
Product name: hPPIL2 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-13843-1
Sigma Product ID: EHU138431
Species: Homo sapiens
Ensembl Gene ID: ENSG00000100023
Ensembl Transcript ID: ENST00000335025, ENST00000398831, ENST00000406385, ENST00000417788, ENST00000484439, ENST00000626352
Gene coordinates (GRCh38): 22:21666009-21700015
HGNC Alias: CYC4, Cyp-60, UBOX7
HGNC ID: HGNC:9261
HGNC Symbol: PPIL2
NCBI gene: 23759
RefSeq mRNA: NM_001317996, NM_014337, NM_148175, NM_148176
Sequence:GCAATGGAGAGAAGCTGGACGGGAGGTCCCTGATCAAGCTGAACTTTTCCAAGAA
CAGTGAGGGGAAGTACCACTGCCCAGTGCTGTTTACCGTGTTCACCAACAACACC
CACATCGTGGCTGTGAGGACGACCGGCAACGTCTACGCCTATGAGGCAGTGGAAC
AGCTAAATATCAAGGCCAAGAACTTCCGGGACCTGCTGACCGACGAGCCCTTCTC
CCGGCAGGACATCATCACCCTCCAGGACCCCACCAATTTGGACAAGTTCAATGTC
TCTAACTTCTATCATGTGAAGAATAACATGAAAATAATAGACCCAGATGAAGAGA
AGGCCAAACAGGACCCGTCTTATTATCTGAAAAATACAAATGCCGAGACCCGAGA
GACCCTGCAGGAGCTCTACAAGGAGTTCAAAGGGGACGAGATTCTG
Product name: hPPIL2 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-13843-1
Sigma Product ID: EHU138431
Species: Homo sapiens
Ensembl Gene ID: ENSG00000100023
Ensembl Transcript ID: ENST00000335025, ENST00000398831, ENST00000406385, ENST00000417788, ENST00000484439, ENST00000626352
Gene coordinates (GRCh38): 22:21666009-21700015
HGNC Alias: CYC4, Cyp-60, UBOX7
HGNC ID: HGNC:9261
HGNC Symbol: PPIL2
NCBI gene: 23759
RefSeq mRNA: NM_001317996, NM_014337, NM_148175, NM_148176
Sequence:GCAATGGAGAGAAGCTGGACGGGAGGTCCCTGATCAAGCTGAACTTTTCCAAGAA
CAGTGAGGGGAAGTACCACTGCCCAGTGCTGTTTACCGTGTTCACCAACAACACC
CACATCGTGGCTGTGAGGACGACCGGCAACGTCTACGCCTATGAGGCAGTGGAAC
AGCTAAATATCAAGGCCAAGAACTTCCGGGACCTGCTGACCGACGAGCCCTTCTC
CCGGCAGGACATCATCACCCTCCAGGACCCCACCAATTTGGACAAGTTCAATGTC
TCTAACTTCTATCATGTGAAGAATAACATGAAAATAATAGACCCAGATGAAGAGA
AGGCCAAACAGGACCCGTCTTATTATCTGAAAAATACAAATGCCGAGACCCGAGA
GACCCTGCAGGAGCTCTACAAGGAGTTCAAAGGGGACGAGATTCTG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.