Search our product database

Search options:
Product name: hRELA €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-14146-1
Sigma Product ID: EHU141461
Species: Homo sapiens
Ensembl Gene ID: ENSG00000173039
Ensembl Transcript ID: ENST00000308639, ENST00000406246, ENST00000525658, ENST00000525693, ENST00000526283, ENST00000527749, ENST00000531484, ENST00000532999, ENST00000534558, ENST00000612991, ENST00000615805
Gene coordinates (GRCh38): 11:65653596-65663094
HGNC Alias: NFKB3, p65
HGNC ID: HGNC:9955
HGNC Symbol: RELA
NCBI gene: 5970
RefSeq mRNA: NM_001145138, NM_001243984, NM_001243985, NM_021975
Sequence:TCAATGGCTACACAGGACCAGGGACAGTGCGCATCTCCCTGGTCACCAAGGACCC
TCCTCACCGGCCTCACCCCCACGAGCTTGTAGGAAAGGACTGCCGGGATGGCTTC
TATGAGGCTGAGCTCTGCCCGGACCGCTGCATCCACAGTTTCCAGAACCTGGGAA
TCCAGTGTGTGAAGAAGCGGGACCTGGAGCAGGCTATCAGTCAGCGCATCCAGAC
CAACAACAACCCCTTCCAAGTTCCTATAGAAGAGCAGCGTGGGGACTACGACCTG
AATGCTGTGCGGCTCTGCTTCCAGGTGACAGTGCGGGACCCATCAGGCAGGCCCC
TCCGCCTGCCGCCTGTCCTTTCTCATCCCATCTTTGACAATCGTGCCCCCAACAC
TGCCGAGCTCAAGAT
Product name: hRELA €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-14146-1
Sigma Product ID: EHU141461
Species: Homo sapiens
Ensembl Gene ID: ENSG00000173039
Ensembl Transcript ID: ENST00000308639, ENST00000406246, ENST00000525658, ENST00000525693, ENST00000526283, ENST00000527749, ENST00000531484, ENST00000532999, ENST00000534558, ENST00000612991, ENST00000615805
Gene coordinates (GRCh38): 11:65653596-65663094
HGNC Alias: NFKB3, p65
HGNC ID: HGNC:9955
HGNC Symbol: RELA
NCBI gene: 5970
RefSeq mRNA: NM_001145138, NM_001243984, NM_001243985, NM_021975
Sequence:TCAATGGCTACACAGGACCAGGGACAGTGCGCATCTCCCTGGTCACCAAGGACCC
TCCTCACCGGCCTCACCCCCACGAGCTTGTAGGAAAGGACTGCCGGGATGGCTTC
TATGAGGCTGAGCTCTGCCCGGACCGCTGCATCCACAGTTTCCAGAACCTGGGAA
TCCAGTGTGTGAAGAAGCGGGACCTGGAGCAGGCTATCAGTCAGCGCATCCAGAC
CAACAACAACCCCTTCCAAGTTCCTATAGAAGAGCAGCGTGGGGACTACGACCTG
AATGCTGTGCGGCTCTGCTTCCAGGTGACAGTGCGGGACCCATCAGGCAGGCCCC
TCCGCCTGCCGCCTGTCCTTTCTCATCCCATCTTTGACAATCGTGCCCCCAACAC
TGCCGAGCTCAAGAT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.