Search our product database

Search options:
Product name: hBAG3 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-14307-1
Sigma Product ID: EHU143071
Species: Homo sapiens
Ensembl Gene ID: ENSG00000151929
Ensembl Transcript ID: ENST00000369085
Gene coordinates (GRCh38): 10:119651370-119677819
HGNC ID: HGNC:939
HGNC Symbol: BAG3
NCBI gene: 9531
RefSeq mRNA: NM_004281
Sequence:CCGCAAAGAGGTGGATTCTAAACCTGTTTCCCAGAAGCCCCCACCTCCCTCTGAG
AAGGTAGAGGTGAAAGTTCCCCCTGCTCCAGTTCCTTGTCCTCCTCCCAGCCCTG
GCCCTTCTGCTGTCCCCTCTTCCCCCAAGAGTGTGGCTACAGAAGAGAGGGCAGC
CCCCAGCACTGCCCCTGCAGAAGCTACACCTCCAAAACCAGGAGAAGCCGAGGCT
CCCCCAAAACATCCAGGAGTGCTGAAAGTGGAAGCCATCCTGGAGAAGGTACAGG
GGCTGGAGCAGGCTGTAGACAACTTTGAAGGCAAGAAGACTGACAAAAAGTACCT
GATGATCGAAGAGTATTTGACCAAAGAGCTGCTGGCCCTGGATTCAGTGGACCCC
GAGGGACGAGCCGATGTGCGTCAGGCCAGGAGAGACGGTGTCAGGAAGGTTCAGA
CCATCTTGGAAAAACTTGAACAGAAAGCCATTGATGTCCCAGGTCAAGTCCAG
Product name: hBAG3 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-14307-1
Sigma Product ID: EHU143071
Species: Homo sapiens
Ensembl Gene ID: ENSG00000151929
Ensembl Transcript ID: ENST00000369085
Gene coordinates (GRCh38): 10:119651370-119677819
HGNC ID: HGNC:939
HGNC Symbol: BAG3
NCBI gene: 9531
RefSeq mRNA: NM_004281
Sequence:CCGCAAAGAGGTGGATTCTAAACCTGTTTCCCAGAAGCCCCCACCTCCCTCTGAG
AAGGTAGAGGTGAAAGTTCCCCCTGCTCCAGTTCCTTGTCCTCCTCCCAGCCCTG
GCCCTTCTGCTGTCCCCTCTTCCCCCAAGAGTGTGGCTACAGAAGAGAGGGCAGC
CCCCAGCACTGCCCCTGCAGAAGCTACACCTCCAAAACCAGGAGAAGCCGAGGCT
CCCCCAAAACATCCAGGAGTGCTGAAAGTGGAAGCCATCCTGGAGAAGGTACAGG
GGCTGGAGCAGGCTGTAGACAACTTTGAAGGCAAGAAGACTGACAAAAAGTACCT
GATGATCGAAGAGTATTTGACCAAAGAGCTGCTGGCCCTGGATTCAGTGGACCCC
GAGGGACGAGCCGATGTGCGTCAGGCCAGGAGAGACGGTGTCAGGAAGGTTCAGA
CCATCTTGGAAAAACTTGAACAGAAAGCCATTGATGTCCCAGGTCAAGTCCAG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.