Search our product database

Search options:
Product name: hPPP2R3C €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-14398-1
Sigma Product ID: EHU143981
Species: Homo sapiens
Ensembl Gene ID: ENSG00000092020
Ensembl Transcript ID: ENST00000261475, ENST00000554222, ENST00000557217
Gene coordinates (GRCh38): 14:35085467-35122517
HGNC Alias: C14orf10, FLJ20644, G4-1, G5PR
HGNC ID: HGNC:17485
HGNC Symbol: PPP2R3C
NCBI gene: 55012
RefSeq mRNA: NM_001305155, NM_001305156, NM_017917
Sequence:TTCTGCTCCTTCTGCCCTAAGAGTTTATGGCCAGTACTTGAATCTTGATAAAGAT
CACAATGGCATGCTCAGTAAAGAAGAACTCTCACGCTATGGAACAGCTACCATGA
CCAATGTCTTCTTAGACCGTGTTTTCCAGGAGTGTCTCACTTATGATGGAGAAAT
GGACTATAAGACCTACTTGGACTTTGTCCTTGCATTAGAAAACAGAAAGGAACCT
GCAGCTCTACAATATATTTTCAAACTGCTTGATATTGAGAACAAAGGATACCTGA
ATGTCTTTTCACTTAATTATTTCTTTAGGGCCATACAGGAACTAATGAAAATCCA
TGGACAAGATCCTGTTTCATTTCAAGATGTCAAGGATGAAATCTTTGACATGGTA
AAACCAAAGGATCCTTTGAAAATCTCTCTTCAGGATTTAATCAACAGTAATCAAG
GAGACACAGTAACCACCATTCTAATCGATTTGAATGGCTTCTGGACTTACG
Product name: hPPP2R3C €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-14398-1
Sigma Product ID: EHU143981
Species: Homo sapiens
Ensembl Gene ID: ENSG00000092020
Ensembl Transcript ID: ENST00000261475, ENST00000554222, ENST00000557217
Gene coordinates (GRCh38): 14:35085467-35122517
HGNC Alias: C14orf10, FLJ20644, G4-1, G5PR
HGNC ID: HGNC:17485
HGNC Symbol: PPP2R3C
NCBI gene: 55012
RefSeq mRNA: NM_001305155, NM_001305156, NM_017917
Sequence:TTCTGCTCCTTCTGCCCTAAGAGTTTATGGCCAGTACTTGAATCTTGATAAAGAT
CACAATGGCATGCTCAGTAAAGAAGAACTCTCACGCTATGGAACAGCTACCATGA
CCAATGTCTTCTTAGACCGTGTTTTCCAGGAGTGTCTCACTTATGATGGAGAAAT
GGACTATAAGACCTACTTGGACTTTGTCCTTGCATTAGAAAACAGAAAGGAACCT
GCAGCTCTACAATATATTTTCAAACTGCTTGATATTGAGAACAAAGGATACCTGA
ATGTCTTTTCACTTAATTATTTCTTTAGGGCCATACAGGAACTAATGAAAATCCA
TGGACAAGATCCTGTTTCATTTCAAGATGTCAAGGATGAAATCTTTGACATGGTA
AAACCAAAGGATCCTTTGAAAATCTCTCTTCAGGATTTAATCAACAGTAATCAAG
GAGACACAGTAACCACCATTCTAATCGATTTGAATGGCTTCTGGACTTACG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.