Search our product database

Search options:
Product name: hTHAP11 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-14456-1
Sigma Product ID: EHU144561
Species: Homo sapiens
Ensembl Gene ID: ENSG00000168286
Ensembl Transcript ID: ENST00000303596
Gene coordinates (GRCh38): 16:67842082-67844195
HGNC Alias: CTG-B43a, CTG-B45d, HRIHFB2206
HGNC ID: HGNC:23194
HGNC Symbol: THAP11
NCBI gene: 57215
RefSeq mRNA: NM_020457
Sequence:GGAGTTACAGGCTGCTACCGCAGGGCTGGAGGCTGCCGAGTGCCCTATGGGCCCC
CAGTTGGTGGTGGTAGGGGAAGAGGGCTTCCCTGATACTGGCTCCGACCATTCGT
ACTCCTTGTCGTCAGGCACCACGGAGGAGGAGCTCCTGCGCAAGCTGAATGAGCA
GCGGGACATCCTGGCTCTGATGGAAGTGAAGATGAAAGAGATGAAAGGCAGCATT
CGCCACCTGCGTCTCACTGAGGCCAAGCTGCGCGAAGAACTGCGTGAGAAGGATC
GGCTGCTTGCCATGGCTGTCATCCGCAAGAAGCACGGAATGTGAACTGGTGCCCC
GGCAGCCTGCTGGACTCCCAGACCCCATCCAGCCAGGGGACCGCAGGCCATTGTT
GAACTCCTCTATACTCCTGGGCACTGGTTG
Product name: hTHAP11 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-14456-1
Sigma Product ID: EHU144561
Species: Homo sapiens
Ensembl Gene ID: ENSG00000168286
Ensembl Transcript ID: ENST00000303596
Gene coordinates (GRCh38): 16:67842082-67844195
HGNC Alias: CTG-B43a, CTG-B45d, HRIHFB2206
HGNC ID: HGNC:23194
HGNC Symbol: THAP11
NCBI gene: 57215
RefSeq mRNA: NM_020457
Sequence:GGAGTTACAGGCTGCTACCGCAGGGCTGGAGGCTGCCGAGTGCCCTATGGGCCCC
CAGTTGGTGGTGGTAGGGGAAGAGGGCTTCCCTGATACTGGCTCCGACCATTCGT
ACTCCTTGTCGTCAGGCACCACGGAGGAGGAGCTCCTGCGCAAGCTGAATGAGCA
GCGGGACATCCTGGCTCTGATGGAAGTGAAGATGAAAGAGATGAAAGGCAGCATT
CGCCACCTGCGTCTCACTGAGGCCAAGCTGCGCGAAGAACTGCGTGAGAAGGATC
GGCTGCTTGCCATGGCTGTCATCCGCAAGAAGCACGGAATGTGAACTGGTGCCCC
GGCAGCCTGCTGGACTCCCAGACCCCATCCAGCCAGGGGACCGCAGGCCATTGTT
GAACTCCTCTATACTCCTGGGCACTGGTTG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.