Search our product database

Search options:
Product name: hDYNLL1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-14720-1
Sigma Product ID: EHU147201
Species: Homo sapiens
Ensembl Gene ID: ENSG00000088986
Ensembl Transcript ID: ENST00000242577, ENST00000392508, ENST00000392509
Gene coordinates (GRCh38): 12:120469850-120498493
HGNC Alias: DLC1, DLC8, DNCL1, hdlc1, LC8, PIN
HGNC ID: HGNC:15476
HGNC Symbol: DYNLL1
NCBI gene: 8655
RefSeq mRNA: NM_001037494, NM_001037495, NM_003746
Sequence:TGTCGGAAGAGATGCAACAGGACTCGGTGGAGTGCGCTACTCAGGCGCTGGAGAA
ATACAACATAGAGAAGGACATTGCGGCTCATATCAAGAAGGAATTTGACAAGAAG
TACAATCCCACCTGGCATTGCATCGTGGGGAGGAACTTCGGTAGTTATGTGACAC
ATGAAACCAAACACTTCATCTACTTCTACCTGGGCCAAGTGGCCATTCTTCTGTT
CAAATCTGGTTAAAAGCATGGACTGTGCCACACACCCAGTGATCCATCCAAAAAC
AAGGACTGCAGCCTAAATTCCAAATACCAGAGACTGAAATTTTCAGCCTTGCTAA
GGGAACATCTCGATGTTTGAACCTTTGTTGTGTTTTGTACAGGGCATTCTCTGTA
CTAGTTTGTCGTGGTTATAAAACAATTAGCAGAATAGCCTACATTTGTATTTATT
TTCTATTCCATACTTCTGCCCACG
Product name: hDYNLL1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-14720-1
Sigma Product ID: EHU147201
Species: Homo sapiens
Ensembl Gene ID: ENSG00000088986
Ensembl Transcript ID: ENST00000242577, ENST00000392508, ENST00000392509
Gene coordinates (GRCh38): 12:120469850-120498493
HGNC Alias: DLC1, DLC8, DNCL1, hdlc1, LC8, PIN
HGNC ID: HGNC:15476
HGNC Symbol: DYNLL1
NCBI gene: 8655
RefSeq mRNA: NM_001037494, NM_001037495, NM_003746
Sequence:TGTCGGAAGAGATGCAACAGGACTCGGTGGAGTGCGCTACTCAGGCGCTGGAGAA
ATACAACATAGAGAAGGACATTGCGGCTCATATCAAGAAGGAATTTGACAAGAAG
TACAATCCCACCTGGCATTGCATCGTGGGGAGGAACTTCGGTAGTTATGTGACAC
ATGAAACCAAACACTTCATCTACTTCTACCTGGGCCAAGTGGCCATTCTTCTGTT
CAAATCTGGTTAAAAGCATGGACTGTGCCACACACCCAGTGATCCATCCAAAAAC
AAGGACTGCAGCCTAAATTCCAAATACCAGAGACTGAAATTTTCAGCCTTGCTAA
GGGAACATCTCGATGTTTGAACCTTTGTTGTGTTTTGTACAGGGCATTCTCTGTA
CTAGTTTGTCGTGGTTATAAAACAATTAGCAGAATAGCCTACATTTGTATTTATT
TTCTATTCCATACTTCTGCCCACG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.